DNA Mutations Section 11.3. Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

Slides:



Advertisements
Similar presentations
DNA, RNA, and Proteins By Liz LaRosa
Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
DNA and Protein Synthesis DNA contains the genetic information to make amino acids Amino acids combine to make proteins These proteins determine the physical.
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
MUTATIONS Section 11.3 pgs
Section 11.3 MUTATIONS Section 11.3 pgs
Genetic Changes 11.3.
DNA and Genes Chapter DNA: The Molecule of Heredity Objectives Analyze the structure of DNA Determine how the structure of DNA enables it to.
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation
Gene Mutations Chapter 11.
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
Mutations that happen during Transcription and Translation
DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
Section 11.3 MUTATIONS Section 11.3 pgs
From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.
MUTATIONS Intro video
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Mutation Notes: Chapter 11.
Section 11.3: Genetic Changes
Mutations.
Mutations.
Mutations.
11.3 Mutations.
Mutations.
Translation: From RNA to Proteins
Mermaid Syndrome Video.
Gene Mutations Chapter 11.
Genetic Mutations.
Gene Mutations.
MUTATIONS.
Protein Synthesis.
Mutations.
Mutations.
To be successful today…
11.3 Section Objectives – page 296
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Mutations A mutation is any change in the DNA sequence.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.
Mutations changes in genetic material (_____).
Mutations A mutation is any change in the DNA sequence.
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
10th Grade Biology Mr. Walker
Genetic Mutations.
I. Mutations A change in the genetic code
11.3 Section Objectives – page 296
Mutations.
Mutations.
Mutations: Changes in Genes
Presentation transcript:

DNA Mutations Section 11.3

Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation mRNA Amino acid sequence

Mutation—mistakes in the DNA Mistakes can occur randomly through errors in replication, transcription, or cell division. External factors can also cause mutations.

Mutations can occur in reproductive cells (sperm or egg) or in body cells. Only adult cells affected Only offspring affected New protein that is better than before New protein hurts organism or doesn’t work at all. Mutation in body cell Mutation in sperm or egg Cell may no longer work properly Cell doesn’t reproduce properly  may lead to cancer

Certain types of mutations are found in the genes or DNA Point mutation is the change in a single base pair. –EX. When you change one letter in a sentence: THE DOG BIT THE CAT. THE DOG BIT THE CAR.

DNA mutations con’t Frameshift mutation is when one base is deleted or inserted and the whole sequence shifts. –EX: If you delete the letter G, from the original sentence: THE DOG BIT THE CAT. THE DOB ITT HEC AT. –EX: If you insert the letter A, into the sequence. THE DOG ABI TTH ECA T.

Chromosomes carry large amounts of genetic material and can also have mutations

Mutation causes are called mutagens. Radiation (nuclear, x-ray, UV, etc), asbestos, formaldehyde all can lead to mutations. Organisms have evolved several enzymes that check and repair DNA, but the more exposure to a substance, the more chances for mistakes.