Bellwork 1. What do you think the word gel electrophoresis means? 2. Who can move most quickly through a thick, dense forest: a human, a dog, or a rabbit?

Slides:

Advertisements

Similar presentations

Loading Gels. The Gel Box Electrode Lid Tray to hold gel Connect to power supply.

Advertisements

An Introduction to Microvolumetrics and Pipetting

Gel electrophoresis The gel electrophoresis method was developed in the late 1960's. It is a fundamental tool for DNA sequencing.

Gel Electrophoresis of DNA

Copyright © 2007, Pearson Education, Inc., Publishing as Pearson Addison-Wesley. Coulomb Force The field model and the electric field Chapter 20 Electric.

CHAPTER 1: Some Tools of the Trade Lab

Gel Electrophoresis Gel Electrophoresis.

Biotech Lab #5 DNA Goes to the Races “Gel electrophoresis”

Outbreak Lab: In this lab, biotech procedures will be used to see if a sample of viral DNA is the deadly Alabama virus. The specific technique that you.

Separation of Proteins by Gel Electrophoresis Carolina Biological Kit #

“Gel electrophoresis”. Gel electrophoresis is a procedure for separating a mixture of molecules through a stationary material (gel) in an electrical field.

Gel Electrophoresis & Gel Loading Practice. Gel Electrophoresis The process by which electricity is used to separate charged molecules (DNA fragments,

Prepered by:- Rana Al-Turki

Copyright © 2007, Pearson Education, Inc., Publishing as Pearson Addison-Wesley. Coulomb Force The field model and the electric field Chapter 20 Electric.

National Centre for Biotechnology Education Gel electrophoresis Protein power! Copyright © Dean Madden, 2010.

Copyright © 2007, Pearson Education, Inc., Publishing as Pearson Addison-Wesley. Coulomb Force The field model and the electric field Chapter 20 Electric.

Land and Sea Breezes Good Day Fill in your agenda.

DNA Analysis Using Agarose Gel Electrophoresis Day 1

Collect Buccal Cells. PCR Polymerase Chain Reaction DNA/gene amplification.

DNA Structure and Analysis Activity 4.3: Dye Electrophoresis.

Solar Energy Station Directions. Making a Solar-Powered Circuit 1.Make sure your solar panel is in direct sun. 2.Get the clear LED bulb. 3.Use a red jumper.

Gel Electrophoresis. What is Gel Electrophoresis? Gel electrophoresis separates molecules on the basis of their charge and size. The charged macromolecules.

Gel Electrophoresis of DNA

AGENDA Who Done It Workshop Continental Breakfast Welcome and Introductions Who Done It Lab Overview of SCBC Resources on MATSC Reserving Your Kit on LARS.

1962: Nobel Prize in Physiology and Medicine James D. Watson Francis H. Crick Maurice H. F. Wilkins What about? Rosalind Franklin.

Biotechnology Introduction Gel Electrophoresis. Method of analyzing DNA Allows a researcher to determine how alike or different two samples of DNA are.

Analysis of DNA Fragments with Gel Electrophoresis

Lab 23 Goals and Objectives: ***Begin lab before lecture!!! EDVOKIT#124: DNA-based Screening for Smallpox Practice loading samples into “submarine gels”

Bellwork Look at the picture: 1. Which fragment, A, B, or C is smallest? 2. Which fragment is largest? 3. What is the charge of DNA? 4. Based.

Agarose (Horizontal) Gel Electrophoresis Malasian word for seaweed is “agar-agar”. Agarose is derived from red seaweed. Electrophoresis means “carrying.

Biotechnology Biotechnology: The use of microorganisms, cells or cell components to make a product. Genetic Engineering: inserting genes into cells for.

Introduction to Gel Electrophoresis. Outline How to prepare a gel How to micropipet Practice setting up electrophoresis Discussion viewing of gel –In.

Wildlife Forensics Environmental Study Center. Chinchilla.

Gel Electrophoresis.

DNA Reinforcement Activities. Complete this concept map By listing 3 situations in which you would conduct the following DNA PROFILES: DNA profiles are.

1. Summarize each of the 6 steps of transcription 2. Make an mRNA copy from the DNA gene: GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know.

Gel Electrophoresis of DNA. What is Gel Electrophoresis? Electro = flow of electricity, phoresis, from the Greek = to carry across A gel is a colloid,

DNA Fingerprinting Agarose Gel Electrophoresis Student Instructions

Gel Electrophoresis What is Gel Electrophoresis? Gel electrophoresis separates molecules on the basis of their charge and size. The charged macromolecules.

What happens now that the DNA has been extracted?

Gel Electrophoresis Biotechnology Unit. Principles of Electrophoresis Definition – Process in which particle, DNA, RNA and proteins- or their fragments.

Gel Electrophoresis gel electrophoresis – moving DNA through a gel medium using an electric current Why can we move DNA with electricity? DNA has a negative.

Lab 23 Goals and Objectives: ***Begin lab before lecture!!! EDVOKIT#124: DNA-based Screening for Smallpox Our DNA samples: -collect patient sample (blood,

ARE FOOD COLORS FROM DIFFERENT BRANDS MADE FROM THE SAME DYES ?

Gel Electrophoresis. What is Gel Electrophoresis? Electrophoresis: Movement of charged particles through a solution (gel) under the influence of an electric.

Gel Electrophoresis UNIT 5 – DNA THIS IS ON THE WEBSITE SO YOU CAN USE IT FOR YOUR REPORT. Use this PowerPoint to complete writing you lab report. Lab.

***Begin lab before lecture!!!

List general characteristics of all races

An Introduction to Microvolumetrics and Pipetting

PCR - Electrophoresis Adding primers to the DNA for the PCR process.

The Scientific Method Learning Target Goal:

Outbreak Lab: In this lab, biotech procedures will be used to see if a sample of viral DNA is the deadly Alabama virus. The specific technique that you.

Gel Electrophoresis of DNA

Biology Bellringer Choose Lab group

Electrophoresis The purpose of electrophoresis is to separate molecules of DNA, RNA or protein. Separation can be based upon: Size Shape Isoelectric point.

Gel Electrophoresis Method of separating molecules within an electric field based on the size and charge of DNA fragments.

Introduction to Gel Electrophoresis

Biotech Lab #3 DNA Goes to the Races

Opening Activity: March 12, 2018

Biotechnology Genetic Testing.

An Introduction to Microvolumetrics and Pipetting

Agarose Gel Electrophoresis

Restriction Enzymes The ability to cut and paste DNA predictably is due to the use of restriction enzymes. They were first identified in and isolated.

Creating a DNA Fingerprint by Gel Electrophoresis

Gobstopper Lab What will happen when Gobstoppers are placed in water?

Opening Activity: March 20, 2017

Gel Electrophoresis 3/5/18.

ELECTROPHORESIS of serum proteins and dna

Gel Electrophoresis Gel Electrophoresis.

Presentation transcript:

Bellwork 1. What do you think the word gel electrophoresis means? 2. Who can move most quickly through a thick, dense forest: a human, a dog, or a rabbit? 3. Why do you think that?

In the lab Go to the lab and set up your gel box. The flat side of the black wedge should face inwards. The comb must go in the middle. Raise your hand. A biotechnology student will check your set-up and pour your gel when you group is ready COMBCOMB

Copy into your lab book: Title: Gel Electrophoresis Lab Questions (write on your lab paper)- What is the relative size and charge of the dyes today? What dyes are in the unknown sample (X)?

What is DNA’s charge? If DNA is negative, what happens when we turn the electricity on?

How does gel electrophoresis work?

Look at the gel below Which colors are negative? Positive? Which are large? Small? + _

While the agarose hardens…. Write an if-then-as measured by hypothesis Mention size and charge in your prediction: Example: If dye #97 moves a short distance towards the positive pole…

Make a record of what goes where!! 1. Draw a picture of your gel and indicate where each sample will go (remember there are 8 wells and 6 samples) X

Load and run YOUR gels!! 1. Use the yellow pipettor with a fresh tip to load each dye sample. 2. Raise your hand to have a biotech student add the buffer when you are done 3. Connect cables and run the gel at 150 volts for 10 minutes. Note the starting time. 4. While you wait, make quantitative & qualitative observations and lab notes. (Note any dye spills or over flow. Did your pipettor tip puncture the gel? Can you see any thing happen in the box?)

Conclusions- 1-2P in notebook 1. What conclusions can you make about your gel? Which dyes are smallest? Largest? Positive? Negative? 2. What dyes make up the unknown (X sample)? 3. Compare the relative size of one of the positively charged dyes, to one of the negatively charged dyes. Identify dyes in this comparison by number and color. Use the side (+ or -) the dye move towards, and measure the distance from the center for this analysis. 4. How about your hypothesis?...(Supported or refuted? Explain)