Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit.

Slides:



Advertisements
Similar presentations
The Human Tissue Act and You Steve Hopkins Designated Individual for Research Tissue
Advertisements

Leeds Institute of Molecular Medicine Pathology and Tumour Biology Research Tissue Banking Making a GIFT for the future.
The Veterans Affairs Central Biorepository and MVP Highlights Mary T
Sample Transfer Dr Zoe Davison Central Bank, Newcastle 6/ 7/ 2011.
New Papworth Hospital Bidders’ Day 7 September 2010.
Cancer of Unknown Primary Dr Chris Jones Consultant Medical Oncologist North of England Cancer Network Annual Conference 20 September 2013.
Linda Ward Clinical Review & Effectiveness Specialist, EMSCG Primary care treatment funding decisions: developing a resource to.
1 Post Graduate Training. 2 Enhanced Structured & Formative Training Designated core faculty with protected time PEOPLE Regular formative assessments.
The Imperial College Tissue Bank A searchable catalogue for tissues, research projects and data outcomes Prof Gerry Thomas - Dept. Surgery & Cancer The.
GCP compliance for GenISIS  This presentation is intended for clinical staff involved in recruiting patients to the GenISIS (Genetics of Influenza Susceptibility.
Consent for Research Study A Study for Women with Advanced Cervical Cancer: Learning whether an MRI scan with an investigative contrast agent (called.
Epigenetics of Celiac Disease MEDICEL Malta 2011.
The Nuffield Council on Bioethics Report : The collection, linking and use of data in biomedical research and health care: ethical issues. Martin Richards.
BMJ Case Reports publishing, sharing and learning through experience.
SYNOPSIS OF THE PROTOCOL Title: Pregnancy Associated Breast Cancer (PABC); Prospective Data Registry in Saudi Arabia Sponsor: Oncology Department, King.
CALGB Informational Session June 22, 2007 David Hurd, MD Interim Chair Data Audit Committee.
Medical Research BADRAG meeting Jan 2013 Dr H Sari-Kouzel.
Right Patient, Right Blood
Consultant Pharmacists
05/09/2015www.ecrin.org1 European Clinical Research Infrastructures Network
ACRIN 6671/GOG 0233 Consent for Research Study A study for Women with Advanced Cervical Cancer: Learning whether a PET/CT scan using an imaging agent called.
E2F3 in Soft Tissue Sarcoma Development M. Scurr; A Feber; J Shipley; A Fletcher; N Dennis; I Judson; C Cooper.
Objectives of Work Package 5 objectives for today Information on centres of expertise for rare cancers WP leader: Sabine Siesling.
CCHMC’s Biobanking Software – James Morgan April 3, 2014 B iomaterial T racking & M anagement B iomaterial T racking & M anagement.
Future Use of Stored Samples & Data and the NIH Policy on GWAS and dbGaP NIAID/DAIDS Dione Washington, M.S. -- ProPEP Sudha Srinivasan, Ph.D.-- TRP Tanisha.
Conducting Research in the UK National Health Service Dr Stephen Brett Reader In Critical Care.
Mesothelioma Collections September 2010 through September 2011.
Experimental Cancer Medicine – the future of cancer care Rosie Davies (LECMC RP based at RLUH) Janet Davies (LECMC RP based at CCO)
100k Genomes Project In December 2012 the Prime Minister announced a programme of Whole Genome Sequencing as part of the UK Government’s Life Sciences.
Biobanks of Cerice Center for Gene Expression Research in Cancer Epidemiology Eiliv Lund, UiTø.
New Oslo PSC biobank.  Broad consent – covers all clinical and research biobanking  Integrated storage of clinical data and biological material  DNA,
IndianaCTSI ACCELERATING CLINICAL AND TRANSLATIONAL RESEARCH Building an Indiana Biorepository Dave A Flockhart Eric Meslin April 19 th, 2010.
VConnolly Acute Medicine – an out-patient specialty? Dr Vincent Connolly The James Cook University Hospital Middlesbrough.
International PSC Study Group Meeting, Oslo, Jun 2010 Cholangiocarcinoma in PSC: Opportunities within a study group Dr Steve Pereira Institute of.
Development of Molecular Methodologies for the Enhanced Detection of Tumour Biomarkers Michelle Wood, Hood Mugalassi, Justyna Tull, Linda Meredith, Rachel.
Dr Godfrey Grech University of Malta
Focus on NHS/Industry Morag McFarlane, PhD “World Leaders in Human Tissue Provision”
Clinical Academic Training - the NIHR scheme. JP Neilson NIHR Dean for Training [DATE] November 2008.
100k Genomes Project Programme of Whole Genome Sequencing, part of UK Life Sciences Strategy Aim to sequence 100,000 genomes from patients with cancer.
Transfusion at the Hospital End Aleksandar Mijovic Consultant Haematologist King’s College Hospital London, UK.
Full Proposal for the German Cancer Aid Priority Program 'Translational Oncology' (2st call) 2015 Lead Applicants: Prof. Dr. med. Magnus von Knebel Doeberitz.
INTERPRETING GENETIC MUTATIONAL DATA FOR CLINICAL ONCOLOGY Ben Ho Park, M.D., Ph.D. Associate Professor of Oncology Johns Hopkins University May 2014.
Facilitating tissue collection for translational research Jane Rogan Business Manager.
Introduction to UCL Dr Kirstin Goldring (Biobank and BioResource Coordinator)
Ukpmc.ac.uk As a result of the mandates Research in the open How mandates work in practice 29 th May, 2009 Paul Davey, UK PubMed Central Engagement Manager,
The National Cancer Research Network is part of the National Institute for Health Research CANCER GENETIC TRIALS Leicestershire, Northamptonshire and Rutland.
Retention period(s) of samples/data Many jurisdictions, as well as hospitals and institutions, mandate retention periods for medical or research-related.
K. Zatloukal The European Research Infrastructure for Biobanking and Biomolecular Resources (BBMRI) Kurt Zatloukal, Medical University of Graz, Austria.
Tissue Access for Patient Benefit Smoothing the pathway between patients, tissue donation, and research Consent Regulation Logistics Processing Allied.
European Patients’ Academy on Therapeutic Innovation Challenges in Personalised Medicine.
Anna Buder Institute of Cancer Research Department of Medicine I Medical University of Vienna Liquid Biopsies Analysis of circulating cell-free tumor-DNA.
San Antonio Breast Cancer Symposium – December 6-10, 2016
Emerging Genomic Technologies: Extending the Application of Genomics to Prediction, Diagnosis, Monitoring, and Early Detection Luis A. Diaz, M.D. Johns.
100,000 genomes project and haematological malignancy
Intermediate Atypical Carcinoma: Novel Histologic Subtype of mCRPC in Patients Resistant to Androgen Receptor Agonists CCO Independent Conference Highlights.
NISCHR Academic Health Science Collaboration Launch
The 100,000 Genomes Project and the West of England Genomic Medicine Centre Brief update and overview provided by Catherine Carpenter-Clawson, Programme.
Biomarker Screening Pilot
 The human genome contains approximately genes.  At any given moment, each of our cells has some combination of these genes turned on & others.
Nat. Rev. Clin. Oncol. doi: /nrclinonc
Nat. Rev. Clin. Oncol. doi: /nrclinonc
Patient information: Research study taking place today
Figure 5 Identification of mucinous carcinoma
Volume 67, Issue 4, Pages (April 2015)
(A) WES of CSF-derived ctDNA collected prior to T-DM1 treatment.
100,000 Genomes Project & mainstreaming genomic medicine
A Multicenter Retrospective Audit of Native Vertebral Osteomyelitis Cases June March 2018.
Figure 1 Overview of the imaging biomarker roadmap
SYNOPSIS OF THE PROTOCOL
Presentation transcript:

Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit and UCL Cancer Institute Open Access UCL 18 th April 2013

European Centre of Excellence new cases/month >1500 cases under follow up NET Biobank Royal Free Academic NET Unit

RARE BUT high prevalence –0.5% malignancies 5/ UK popn Sites –GI tract 62-67% –Lung 22-27% Survival –5yr OS 93% local disease, 74% regional, 19% metastatic disease –12-22% cases present with metastases Neuroendocrine Tumours

Yao, J. C. et al. J Clin Oncol; 26: NET incidence rising

NET patient Hepatobiliary & GI surgery Radiology & Nuclear Medicine Oncology Pathology Gastroenterology Endocrinology Cardiology Genetics Dieticians Palliative care Specialist NET Nurses

Research Objectives Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC

CGTTACGATGGACGGTATGCTCCGTAAG GENE OF INTEREST DNA SEQUENCE DNA METHYLATION RNA EXPRESSION COPY NUMBER ANALYSIS Integrated genomic PNET analysis

Why set up a NET biobank? Garbage in…… Diamonds in……

Governance Infrastructure Human Tissue Authority licence – prospective research tissue bank – framework and guidelines – allows satellite sites Research Ethics Committee approval R & D approval in each participating Trust

Management Infrastructure Policies and Procedures – Quality management system – Risk register – Disaster recovery plan – Incident log

Management Infrastructure Standard Operating Procedures – Collection – Storage – Processing – Equipment Robust tracking system Sample and data audits

What to collect?

Specialised samples Blood (circulating tumour cells, DNA, RNA, miRNA) Metastatic biopsies Cells from ascites/pleural effusions Carcinoid heart valves

Quality Assurance – FF tissue Sections are cut from frozen tissue and stained with haematoxylin and eosin Percentage tumour is assessed for each tumour block

Data entry and storage All samples are labelled with a 2D barcode label and scanned directly into the database to avoid transcription errors Each sample has an anonymised unique identifier Samples are then stored appropriately in the -80 o C freezer

NET Biobank Funding –Raymond and Beverly Sackler Foundation Prospectively consent and collect tissue / biological samples Robust infrastructure, HTA compliant

Benefits of banking within UCL/RFH Biobank Infrastructure Staff Resources Cheaper than going it alone Improves funding opportunities

NET BioBank Jan 2013 holdings Subjects218 Sampling events2678 Fresh tissue107 Serum1264 Plasma1280 Cell pellets99

Clinical Database Full time Clinical Data Manager Bespoke secure web accessed database –Interface with Cerner ~1000 patients entered Improve efficiency and quality of clinical audit and research

Key findings Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Reassignment of Ki-67 grading ARID1A mutation Supports DNAm findings

Summary =

Acknowledgements Royal Free NET Unit Tim Meyer Martyn Caplin Brian Davidson UCL Cancer Institute - Medical Genomics Stephan Beck Marianne Eymard Harpreet Dibra Laura Schulz Anna Karpathakis Serif Sasmaz Andy FeberUCL-RFH Biobank Lee Butcher Chris Bell UCL Genome Centre Kerra Pearce Mike Hubank Funding Cancer Research UK Raymond and Beverly Sackler Foundation Wellcome Trust / Academy of Medical Sciences contact: