C HAPTER 13: DNA T ECHNOLOGIES Introduction to Biotechnology, BIOL1414 Austin Community College, Biotechnology Dept

L EARNING O UTCOMES Describe the process of semi-conservative DNA replication in cells and compare this method with DNA synthesis in the laboratory Discuss the uses of synthesized oligonucleotides and identify the attributes of good primers Explain the steps of PCR and discuss the components and optimization of the process Describe the function of a thermal cycler and how PCR results are visualized Discuss the benefits and implications of knowing the DNA sequences of humans and other organisms Explain how DNA is sequenced using the Sanger Method and the recent improvements that have increased the efficiency of this process Note about this PowerPoint – There are several links in this PPT that allow you to explore more into different topics. Some of these links are animations, movies, or exercises. Please note, you must be in the slide show to activate the links. You can press F5 any time to active the slide show and “Esc” to exit.

DNA & C HROMOSOMES A DNA molecule, at any given moment, could be involved in: DNA replication Transcription DNA molecules directly code for all the RNA and protein molecules that a cell synthesizes. The 46 chromosomes in human cells are actually 22 homologous pairs, plus 2 sex chromosomes.

DNA & C HROMOSOMES E. coli bacteria cell contains one long, twisted, circular DNA molecule The DNA molecule is 4,639,221 bp and 4403 genes Some E. coli also contain plasmids

DNA R EPLICATION A human body is estimated to have over 20 trillion cells. These cells all originate from a single fertilized egg cell by means of DNA replication. DNA replicates in a semi-conservative fashion in which one strand unzips and each side is copied.

DNA R EPLICATION The first step in replication is for the enzyme helicase to unzip the double stranded DNA and topoisomerase relieves tension along the strand Proteins hold the two strands apart RNA primase creates an RNA primer which lays down on each strand of DNA.

DNA polymerase extends the primer by adding complementary nucleotides. RNase H edits out the RNA primer and DNA pol fills in the gap. DNA ligase connects the two. DNA R EPLICATION

helicase DNA R EPLICATION Leading strand follows helicase. Lagging strand must wait for replication fork to open and therefore forms discontinuous Okazaki fragments. Ligase seals the nicks in the DNA backbone between the Okazaki fragments. Watch! Click here! Watch! Click here! DNA Replication DNA Replication

M AKING DNA IN THE L AB Biotechnicians often need pieces of DNA for research and development Using what we’ve learned from cells, we can also use the same process in the lab to synthesize DNA outside of the cell – in vitro synthesis DNA is commonly synthesized for these applications o Probes o Primers o PCR amplification

O LIGONUCLEOTIDES Oligonucleotides are frequently used as probes for techniques as microarrays Probes are relatively short pieces of DNA (or RNA) with a nucleotide sequence complementary to another sequence being searched for. They can also be used as primers to use in PCR and sequencing reactions A primer is a short piece of DNA or RNA that is complementary to a section of template strand.

I N V ITRO DNA S YNTHESIS The reagents needed include: DNA template The strand from which the new strand is synthesized Primer Complementary to the template strand, where the DNA pol will extend from DNA polymerase Extends off the primer, adding nucleotides complementary to template strand Nucleotides Nucleotide triphosphates (dNTPs) Reaction buffer (Mg ions & DTT) Maintains proper pH for DNA pol activity

P ROBES Probes have sequences complementary to a nucleotide sequence of interest To use a probe the strand (and probe) must be single stranded! The probe is typically associated with a detection system (colorimetric, fluorescent, radioactive)

Microarray A chip containing thousands of pieces of single stranded DNA molecules DNA is isolated from a patient, fluorescently labeled, and hybridized to the microarray A laser scanner measures the intensity of the fluorescence to indicate the binding of the patients DNA to the SNP or gene on the microarray G ENE M ICROARRAY

A PPLICATIONS OF M ICROARRAYS

C ONSTRUCTING P RIMERS Primers are designed to recognize a specific sequence of DNA Called primer design Primer design is critical to the success of the experiments using them – for example PCR or sequencing

C ONSTRUCTING P RIMERS Primer Design Considerations: bp long – too long the annealing temperature is too high, too short will anneal to non-target areas 2. Want 50% G-C content – too high GC content, the melting temperature (required to separate the DNA) will be too high. Too low GC content, the melting temperature is too low 3. Avoid GC at the 3’ end 4. Avoid long repeats – they will fold back over on each other

C ONSTRUCTING P RIMERS YOUR TURN! Design a primer that would be good for recognizing the beginning of the following “sequence of interest.” Describe why your primer is a good one. 3’ACACAGGATACGTGCTGCTCAATGCCATG ATAGCCGGTCACAAGCTAATCCGATTTCGC GCAAATTCCTAAATTCGCTAAAGCGAATCTT CAGGAAGGAACCCCGAAGGCCTTTT-5’

P OLYMERASE C HAIN R EACTION (PCR) PCR is a method by which millions of copies of a DNA segment can be synthesized in a test tube in just a few hours. PCR Reaction Components: 1. Reaction buffer: Maintains pH 2. Forward primers: Recognize one end of the fragment to be amplified 3. Reverse primers: Recognize the other end of the fragment to be amplified 4. Taq polymerase: Special DNA polymerase that remains active at very high temperatures 5. dNTPs: The four deoxynucleotides (A, C, G, T) 6. Magnesium chloride (MgCl 2 ): Necessary cofactor for polymerase activity

PCR E QUIPMENT PCR samples are frequently prepared in thin wall tubes to ensure rapid heating and cooling during cycling Computer controlled heat block to allow rapid heating and cooling Thin Walled TubesThermocycler

PCR 1. Heat samples to 94°C for a minute or so to denature the double stranded template DNA.

PCR 2. Drop temperature to around 50 or 60°C to allow primers to anneal.

PCR 3. Maintain temperature at 72°C for a minute or two to allow the polymerase to elongate the new DNA strands.

PCR The thermal cycler repeats the denaturing, annealing, and elongating temperatures approximately 30 cycles. PCR amplification is logarithmic, meaning the number of copies of the target is doubled every cycle. PCR animation

A PPLICATIONS OF PCR T ECHNOLOGY Research & Development Forensics/criminology Missing children/soldiers Paternity/maternity cases Medical diagnostics Therapeutic drug design Phylogeny/evolutionary studies Animal poaching/endangered species

A PPLICATIONS OF PCR T ECHNOLOGY Cloning by PCR Design primer specific for gene of interest

A PPLICATIONS OF PCR T ECHNOLOGY - VNTR Variable Number Tandem Repeat (VNTR) the abbreviation for variable number of tandem repeats, sections of repeated DNA sequences found at specific locations on certain chromosomes; the number of repeats in a particular VNTR can vary from person to person; used for DNA fingerprinting

A PPLICATIONS OF PCR T ECHNOLOGY - VNTR VNTRs usually occur in introns VNTRs can be amplified by PCR and run on agarose gels to produce unique DNA fingerprints

A PPLICATIONS OF PCR T ECHNOLOGY F ORENSICS (VNTR)

Forensics - Forensics is the application of biology, chemistry, physics, mathematics, and sociology to solve legal problems. A PPLICATIONS OF PCR T ECHNOLOGY - F ORENSICS

CODIS In 1990, the FBI established the Combined DNA Index System (CODIS). It is the core of the national DNA database, and developed specifically to enable forensic DNA laboratories to create searchable DNA databases of authorized DNA profiles. The CODIS software permits laboratories throughout the country to share and compare DNA data. As of 2011, the NDIS contained over 9,635,757 offender profiles and 370,875 forensic profiles. As of April 2011, CODIS had produced over 142,700 hits assisting in more than 137,100 investigations nationally and, 7500 in Texas alone!

Crime Scene Victim Suspect Applications of PCR Technology - Forensics DNA Fingerprinting Animation

A PPLICATIONS OF PCR T ECHNOLOGY D IAGNOSING D ISEASE  Diagnosing Disease

 Paternity Testing A PPLICATIONS OF PCR T ECHNOLOGY P ATERNITY T ESTING

Genealogy animation  Genealogy A PPLICATIONS OF PCR T ECHNOLOGY G ENEALOGY

DNA S EQUENCING Sequencing – determining the order and arrangement of G’s, A’s, T’s and C’s in a segment of DNA.

The Sanger sequencing method uses dideoxy-nucleotides to generate all possible fragments of the DNA molecule to be sequenced. DNA Sequencing deoxynucleotide di deoxynucleotide

Set up four different reactions: Sequencing

Sequencing Animation Click on “Sanger Sequencing”

H UMAN G ENOME P ROJECT Completed in 2003, the Human Genome Project (HGP) was a 13-year project coordinated by the U.S. Department of Energy and the National Institutes of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner; additional contributions came from Japan, France, Germany, China, and others. For more information: an_Genome/project/hgp.shtml an_Genome/project/hgp.shtml

H UMAN G ENOME P ROJECT - GOALS identify all the approximately 20,000-25,000 genes in human DNA determine the sequences of the 3 billion bp store this information in databases improve tools for data analysis address the ethical, legal, and social issues that may arise from the project. Follow this ongoing research on the HGP Milestones page: roject/timeline.shtmlMilestones roject/timeline.shtml

H UMAN G ENOME P ROJECT Francis Collins Craig Venter

H UMAN G ENOME P ROJECT Another goal of the HGP is to sequence the genomes of other species, such as model organisms, pathogens, and crop plants. This goal has also been exceeded, and today the genomes of over 900 species have been sequenced. Much of the reason for the success of the HGP comes from the introduction of new high throughput technologies for DNA sequencing that can use automation and robotics.

Develop new lab technology Automated Sequencing Human Genome Project

H UMAN G ENOME S EQUENCING

H UMAN G ENOME P ROJECT The HGP has been a catalyst for change in the way biologists approach the study of living things. Biologists today using the sophisticated laboratory technology for sequencing DNA are collecting data faster than they can interpret it. A new field called bioinformatics is developing for the storage and management of the data stored in these rapidly growing databases, as well as for the use of a computer as a general tool for discovering how living things work.

H UMAN G ENOME P ROJECT DNA sequencing, PCR, microarray, and bioinformatics have provided so much data that researchers must design, conduct, and report the results of their experiments in ways that are different from those that were standard just a generation ago. Disseminate genome information GenBank database

S EARCHING G EN B ANK GenBank, the database repository of all DNA and protein sequences housed at the National Center for Biotechnology Information ( NCBI ) at the National Institutes of Health (NIH). The sequences in GenBank were submitted by researchers and scientists. Each submission is identified by a unique number called an accession number. BLAST – an acronym for Basic Local Alignment Search Tool, a program that allows researchers to compare biological sequences

Q UESTIONS AND C OMMENTS ?

R EVIEW Q UESTIONS Your Turn! Put your name at the top of a sheet of paper, answer these questions and hand in: 1. How many DNA strands does an E. coli cell contain? How many chromosomes does a human body cell contain? 2. Compare and contrast in vitro DNA synthesis and in vitro DNA synthesis. 3. Why is Taq polymerase used in PCR instead of some other DNA polymerase? 4. What are the three parts to a thermal cycling reaction, and what is the difference in temperature between them? 5. For a DNA fingerprint, many PCR targets are used. Each target is its own VNTR. What is a VNTR? 6. How is ddNTP different from a “regular” dNTP? 7. Where on the Internet may one go to compare DNA sequence data?

R EFERENCES 1. Biotechnology: Science for the New Millennium Ellyn Daugherty.