D.N.A 1. The information carried by a DNA molecule is in A. Its amino acid sequence B. The sugars and phosphates forming its backbone C. The order of the bases in the molecule D. The total number of nucleotides it contains E. The RNA units that make up a molecule DNA replication occurs A. Whenever a cell makes protein B. To repair gene damage caused by mutation C. Before a cell divides D. Whenever a cell needs RNA E. In the cytoplasm of a eukaryotic cell 3. The complementary strand of DNA to the DNA fragment 5’- GGC ATA CAT – 3” is A . 3’ – CCG UAU GUA – 5’ B. 3’ – GTA TAT CCG -5’ C. 3’ – ATG TAT GCC – 5’ D. 3’ – CCG TAT GTA – 5’ E. 3’ – CCG AUA GUA – 5’

From Gene to Protein How Genes Work 2007-2008

What do genes code for? How does DNA code for cells & bodies? DNA how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

transcription and translation The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E     enzyme 1 enzyme 2 enzyme 3 enzyme 4

from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008

Transcription Transcription is the synthesis of messenger RNA (mRNA) from DNA Occurs in the nucleus DNA does not leave the nucleus Analogy: blueprints do not get used at the job site when constructing a house

DNA vs. RNA DNA RNA Contains: Adenine, guanine, cytosine, thymine Adenine, guanine, cytosine, uracil 5-carbon sugar is deoxyribose 5-carbon sugar is ribose Double-stranded Single-stranded

Transcription Making mRNA transcribed DNA strand = template strand enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

Transcription: Initiation Promoter = a specific sequence of DNA (starting point) RNA polymerase binds to the promoter on the DNA molecule Transcription factors (proteins) bind to promoter region to help RNA polymerase find the starting point. RNA polymerase then separates the 2 DNA strands

Transcription: Elongation As RNA polymerase moves along the DNA, it untwists the double helix and separates the strands RNA polymerase adds nucleotides to the 3’ end of the mRNA molecule Follows the base-pairing rules G = C A = U

Matching bases of DNA & RNA U Match RNA bases to DNA bases on one of the DNA strands G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Transcription: Termination Termination signal = sequence of bases in DNA molecule that tell RNA polymerase to stop transcription “finish line” in a race mRNA is released from the DNA

RNA Modifications In eukaryotes, mRNA is edited before it’s sent out of the nucleus 2 major types of modifications: Alteration of mRNA ends RNA splicing

RNA Splicing Genes have stretches of nucleotides that don’t code for anything “junk DNA” Noncoding sequence = introns “intervening sequences” Coding regions = exons During RNA splicing, the introns are removed by enzymes and the exons are joined together

Alteration of mRNA Ends Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 cap add poly-A tail longer tail, mRNA lasts longer: produces more protein eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ATCG AUGCGUGUAAAUGCAUGCGCC mRNA AUCG ? Met Arg Val Asn Ala Cys Ala protein

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

Cracking the code WHYDIDTHEREDBATEATTHEFATRAT 1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base wobble Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

DNA strand mRNA strand – codon Amino acid CGC AGT GAC GCG Alanine UCA Serine CUG Leucine

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG codon (mRNA)

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

Building a polypeptide 1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway

Can you tell the story? RNA polymerase DNA amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Prokaryote vs. Eukaryote genes Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing