1 RNA ( Ribonucleic acid ) Structure: Similar to that of DNA except: 1- it is single stranded polyunucleotide chain. 2- Sugar is ribose 3- Uracil is instead.

Slides:



Advertisements
Similar presentations
The Molecular Genetics of Gene Expression
Advertisements

Transcription & Translation
Transcription: Synthesizing RNA from DNA
1. Important Features a. DNA contains genetic template" for proteins.
PROTEIN SYNTHESIS.
1 RNA ( Ribonucleic acid ) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead.
RNA (Ribonucleic acid)
Transcription: Synthesizing RNA from DNA
From Gene to Protein. Question? u How does DNA control a cell? u By controlling Protein Synthesis. u Proteins are the link between genotype and phenotype.
{ DNA Processes: Transcription and Translation By: Sidney London and Melissa Hampton.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.
From Gene to Protein Chapter 17.
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
1 Gene expression Transcription and Translation. 2 1.Important Features: Eukaryotic cells a. DNA contains genetic template for proteins. b. DNA is found.
Chapter 17 From Gene to Protein
MOLECULAR GENETICS Polypeptide Synthesis Protein Structure Sequence of amino acids Nucleotide Connection Sequence of nucleotides in the gene determines.
DNA Function: Information Transmission. ● DNA is called the “code of life.” What does it code for? *the information (“code”) to make proteins!
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
From Gene to Protein Transcription and Translation Mechanisms of Regulation DNA  RNA  Protein Transcription Translation.
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
Protein Synthesis IB Biology HL 1 Spring 2014 Mrs. Peters.
Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.
Transcription and Translation Topic 3.5. Assessment Statements Compare the structure of RNA and DNA Outline DNA transcription in terms of.
RNA & Transcription. RNA (Ribonucleic Acid) Journal For all your RNA news!
What is central dogma? From DNA to Protein
Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.
PROTEIN SYNTHESIS HOW GENES ARE EXPRESSED. BEADLE AND TATUM-1930’S One Gene-One Enzyme Hypothesis.
Page Example problems: Page 324, #2,3,9. Transcription The process of making… RNA review Very similar to DNA except: Has a ribose sugar instead.
Structure and functions of RNA. RNA is single stranded, contains uracil instead of thymine and ribose instead of deoxyribose sugar. mRNA carries a copy.
RNA, transcription & translation Unit 1 – Human Cells.
Protein Synthesis-Transcription Why are proteins so important? Nearly every function of a living thing is carried out by proteins … -DNA replication.
Transcription and Translation The Objective : To give information about : 1- The typical structure of RNA and its function and types. 2- Differences between.
The beginning of protein synthesis. OVERVIEW  Uses a strand of nuclear DNA to produce a single-stranded RNA molecule  Small section of DNA molecule.
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
From Gene to Protein Transcription and Translation.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Unit 1: DNA and the Genome Structure and function of RNA.
The Central Dogma of Life. replication. Protein Synthesis The information content of DNA is in the form of specific sequences of nucleotides along the.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
The flow of genetic information:
RNA & Transcription.
PROTEIN SYNTHESIS.
21.5 RNA and Transcription A typical ribosome consists of a small subunit and a large subunit. The subunit shapes shown contain both protein and rRNA.
From Genes to Protein Chapter 17.
Transcription and Translation.
Transcription.
Gene Expression: From Gene to Protein
Types of RNA and TRANSCRIPTION
Protein Synthesis.
From Gene to Protein Chapter 17.
RNA, & Protein Synthesis
Protein Synthesis Genetics.
RNA (Ribonucleic acid)
Chapter 10 How Proteins Are Made.
Gene Expression: From Gene to Protein
Protein Synthesis Chapter 10.
PROTEIN SYNTHESIS THE DETAILS.
Chapter 17 From Gene to Protein.
Transcription and Translation
PROTEIN SYNTHESIS.
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
12-3 RNA and Protein Synthesis
GENE EXPRESSION / PROTEIN SYNTHESIS
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Chapter 6.2 McGraw-Hill Ryerson Biology 12 (2011)
LAST UNIT! Energetics.
Presentation transcript:

1 RNA ( Ribonucleic acid ) Structure: Similar to that of DNA except: 1- it is single stranded polyunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal RNA (rRNA) 2- Messenger RNA (mRNA) 3- Transfer RNA (tRNA) RNA are copies from DNA sequences formed by a process called “ transcription”. After transcription some modifications occur to obtain the three types of RNA.

2 1- Ribosomal RNA (rRNA): 80 % of total RNA in the cells are rRNA. rRNA are found in combination with several proteins (about 82 proteins) to form ribosome which is the site of protein synthesis. In Eucaryotic ( mammals),there are 4 size types of rRNA (5S, 5.8S, 18Ss and 28S) representing 2/3 particle mass of the ribosome.

3 2- Messenger RNA (mRNA): comprised only 5% of total cellular RNA. Function: It is the type of RNA that carry the gene of specific protein. it carries the genetic information (code of the protein) from DNA (in the nucleus) to ribosomes (in cystol) where it is used in protein biosynthesis. NB: Three nucleotide bases on mRNA form a codon which is then translated into specific amino acid.

4 3- Transfer RNA (tRNA): tRNA represents 15% of total RNA in the cell. Structure: 1- amino acid attachment site or amino acid acceptor: at 3´ end which terminates with the triplet CCA. 2- Anticodon loop or anticodon triplet Functions of tRNA: 1- transport amino acids to ribosome for protein synthesis. Each tRNA carry only one amino acid. The specific amino acid is attached enzymatically to 3' end of tRNA. 2- Help to ensure the insertion of (adding) the correct amino acid in the polypeptide chain. This function is due to anticodon triplet which recognize the specified codon on mRNA and binds to it by base pairing.

5 Structure of tRNAFuntions of tRNA

6

7

8 Gene expression: Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins. Gene expression in two major steps 1-Transcription: Synthesis of mRNA from DNA. By this process, the gene carried on DNA will transferred into RNA. 2-Translation: The gene on mRNA is translated into a functional protein Transcription = DNA → RNA Translation = RNA → protein

9 Transcription: The enzyme responsible for transcription is RNA polymerase II Steps in RNA synthesis: (Watch Movie) 1)Initiation: The transcription is initiated by the binding of RNA polymerase to a specific region of DNA double helix. This site is called promoter site or promoter region. This region is recognized by sigma factor (subunit) of RNA polymerase. When RNA polymerase recognizes this region, it binds to it leading to a local unwinding (separation) of the promoter region into 2 single strands:

10 a- DNA strand that is transcripted into mRNA and called template strand or antisense strand. b- The other strand is coding strand or sense strand that contains gene to be translated (This strand not transcripted, not used) Direction of transcription: RNA polymerase will read the information sequence on DNA template from 3′ → 5′ direction, so RNA is synthesized antiparallel to DNA template i.e. from 5′ → 3′ direction. 2) RNA elongation: Once RNA polymerase recognizes promoter region, it begins to synthesize a transcript (copy) of DNA template. 3) Termination: Process of elongation of RNA continues until reach what is called : termination region which is recognized by rho factor (subunit in RNA polymerase) resulting in release of the enzyme, and the synthesized RNA

11

12 Notes: 1- The synthesized RNA will have the sequence of the sense strand except for U instead of T. 2- In prokaryotic (bacteria) all types of RNA are synthesized by only one species of RNA polymerase. 3- In Eukaryotic ( mammaians), there are 3 classes of RNA polymerase a- RNA polymerase I: synthesizes the precursor of rRNA named : pre rRNA b- RNA polymerase II: synthesizes pre mRNA c- RNA polymerase III: synthesizes pre tRNA All these enzymes synthesize what is called primary transcript or immature RNAs (pre form) which by some modifications occur after transcription, will give the mature rRNA, mRNA and tRNA.

13 Question: Compare between transcription in prokaryotics (bacteria) and eukaryotics (human)?

14 Post-transcriptional modifications of mRNA: OR called: mRNA processing After transcription, the formed immature mRNA will undergo the following modifications to be mature and functioning: 1) 5′-capping: 5′- end in the first nucleotide is blocked by 7-methyl guanosine triphosphate (7 methyl-GTP). Role of cap: a- help to stabilize and protect mRNA from degradation by 5′ exonucleases in the cytoplasm b- Permit initiation of translation (specifies, where translation should begin).

15

16 2) Poly A tail: chain of about AMP is attached to 3′- end is added after transcription Role of poly A: Help to stabilize mRNA and facilitate its exit from the nucleus. Also protect mRNA from degradation in cytoplasm when move from nucleus (cytoplasm contains 3´exonuclease that degrades mRNA).

17 mRNA ready for splicing (what is splicing?, see next slides)

18 3- RNA splicing: The gene carried now on primary mRNA contains two types of regions: a- coding regions called (exons) which will be translated into a functional protein. b- non coding regions (not code for amino acids of the target protein). These regions called introns. The gene or mRNA to be translated, it must contain only coding sequence ( i.e. exons), for this reason RNA splicing is essential to produce a correct protein by translation. RNA splicing (or called gene splicing) is the process by which introns are removed and exons are joined (spliced) to produce a typical mRNA for translation. Splicing is catalyzed by enzyme called: spliceosome which is a group of nucleoproteins. Splicing is a complex process and involve certain mechanism. Briefly, after a two-step enzymatic reaction, the intron is removed and two neighboring exons are joined together (movie for explanation only)

19

20 RNA splicing (I)

21 RNA splicing (II)

22 RNA splicing (III)

23

24