Regents Biology Mutations Changes to DNA
Regents Biology Mutations Changes to DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
Regents Biology Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses, etc.
Regents Biology Types of mutations Changes to (A,C,T,G bases) in the DNA point mutation change to ONE letter (base) in the DNA may cause change to protein, may not There are 3 types: Missense, Silent, Nonsense frameshift mutation there are 2 Types: Insertion, Deletion Insertion: addition of a new letter (base) in the DNA sequence Deletion: deletion of a letter (base) in the DNA sequence both of these shift the DNA so it changes how the codons are read big changes to protein!
Regents Biology Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Does this change the sentence? A LITTLE!
Regents Biology Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS…
Regents Biology Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
Regents Biology Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? Why not? The code has repeats in it!
Regents Biology Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!
Regents Biology Frameshift Mutation Inserting or deleting one or more nucleotides Changes the “reading frame” like changing a sentence Proteins built incorrectly
Regents Biology Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!
Regents Biology Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT!
Regents Biology Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA Does this change the protein? A LOT!
Regents Biology Cystic fibrosis Broken salt channel in cells strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s
Regents Biology Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! airway salt H2OH2O H2OH2O normal lungs cystic fibrosis cells lining lungs salt channel normal mucus thick mucus mucus & bacteria build up = lung infections & damage
Regents Biology Deletion leads to Cystic fibrosis deletion Loss of one amino acid!
Regents Biology Gene Mutation Animation