Golgi Apparatus & Lysosomes

Slides:



Advertisements
Similar presentations
Protein sorting and the Golgi apparatus
Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Golgi complex László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology Semmelweis University 2008.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Intracellular Compartments ER, Golgi, Endsomes, Lysosomes and Peroxisomes.
Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Biochemistry- Ch 11. Carbohydrates (Cont.) 阮雪芬 NTUT Nov 18, 2002.
CHAPTER 8 Part 2 Cytoplasmic Membrane Systems: Structure, Function, and Membrane Trafficking Copyright © 2008 by John Wiley & Sons, Inc.
Review For Final I. Should I take the final? Can’t hurt you Calculate your average and determine what you need to change your grade.
Lecture 11 Vesicular Trafficking: Lysosomes;
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Lecture 16 Vesicle transport and targeting in the secretory pathway
Vesicular Transport III. N-linked glycosylation because sugar is added to N of asparagine. original precursor oligosaccharide added to most proteins in.
Chemical reactions in cells need to be isolated. Enzymes work in complexes, spatial distribution in cytosol, nucleus Confinement of reactions in organelle.
Lecture 7 - Intracellular compartments and transport II
A view of the eukaryotic cell: Elaborately compartmentalized systems *Generalized animal cell *Generalized plant cell.
8/14/20151 Golgi Apparatus Cell biology. 8/14/20152 The name comes from Italian anatomist Camillo Golgi, who identified it in The name comes from.
Extra credit for Midterm 2
Golgi Apparatus Lecture 10, Cell Biology. Discovery of Golgi body  The Golgi apparatus is noticeable with both light and electron microscope. It is also.
Functions Site for concentrating and packing the materials in other parts of the cell e.g. proteins newly synthesized in the rough ER are transported.
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
BIOL 200 (Section 921) Lecture # 9, 10 June 29/30, 2006 Readings ECB (2nd ed.) Chapter 15 (Whole chapter): Introduction, pp ; Protein Sorting pp.
Molecular and Cellular Biochemistry 2. ER- protein modifications
SYNTHESIS OF GLYCOPROTEINS
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Golgi complex BIOLOGY, Faculty of Medicine and Dentistry László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology.
Golgi Apparatus By: Kousha Zamanipour 306. What is The Golgi Apparatus?  The golgi apparatus can also be referred to as “the post office” of the cell.
ER and Golgi: Working Together! Mr. Nichols PHHS.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
Golgi complex BIOLOGY, Faculty of Medicine and Dentistry László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Chapter 12 Intracellular Compartments and Protein Sorting.
 Golgi apparatus or golgi complex or simple Golgi is an organelle found in most of the eukaryotic cells.  It was one of the first organelle to be.
GOLGI APPARATUs.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
 The Golgi apparatus (Golgi complex, Golgi body, Golgi) is an organelle found in eukaryotic cells. The Golgi apparatus was first discovered by Italian.
Vesicular Trafficking Movement From the ER Through the Golgi.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
How proteins get out of the Golgi apparatus? TGN.
“The post office of the cell”
Golgi complex, secretion and protein transport
Intracellular Vesicular Traffic
glycosylation is a non-template derived phenomenon
Protein Synthesis and Sorting: A Molecular View
Golgi Apparatus Golgi Apparatus
Protein Sorting & Transport
Vesicular Trafficking
Intracellular Vesicular Traffic
Tour of the Cell 1.
The Endomembrane system
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Tour of the Cell
Intracellular Vesicular Traffic
Intracellular Compartments and Transport 2
INTD5000, REVIEW, Lectures C7-C8
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
Components of the endomembrane system:
Golgi apparatus Jermaine and Bianca.
Tour of the Cell
BIOLOGY, Faculty of Dentistry
By: Waleedullah Jan BSc Human Biology
Tour of the Cell
Cystic Fibrosis as a Disease of Misprocessing of the Cystic Fibrosis Transmembrane Conductance Regulator Glycoprotein  John R. Riordan  The American Journal.
Coats, Tethers, Rabs, and SNAREs Work Together to Mediate the Intracellular Destination of a Transport Vesicle  Huaqing Cai, Karin Reinisch, Susan Ferro-Novick 
Chapter 13 Intracellular Vesicular Traffic.
The Golgi apparatus Current Biology
Presentation transcript:

Golgi Apparatus & Lysosomes Lecture 21 BSCI 420/421 Oct 21/22, 2002 “It takes all the running you can do to stay in one place; to get somewhere else, you must run twice as fast.” -The Red Queen to Alice (In Wonderland)

The Golgi apparatus plays a central role in vesicular traffic within cells; the post office of the eukaryotic cell. Red= foreward Blue= retrieval Green= endocytic pathways

Proteins that reside in the ER lumen can escape in a transport vesicle. They are captured and returned by KDEL receptors that bind a KDEL sequence (lys-asp-glu-leu) on ER proteins.

The Golgi apparatus is an ordered series of compartments

TEMs of Golgi Apparatuses. In an animal secretory cell and an algal cell Chlamydomonas (trans) Note convex cis face and concave trans face.

Golgi Functions: A. Oligosaccharide processing 1. N-linked oligosaccharides can be trimmed back to a core of 2 GlcNAc and 3 mannoses then extended to form a complex oligosacc. Or trimmed to a high mannose

This is done in a series of steps starting in the ER and ending in the Golgi

Purposes?- 1. Sorting in TGN 2. Protection from protease digestion 3. Cell to cell adhesion via selectins (chap 19)

Cytochemical demonstration of different compartments of Golgi Unstained nucleoside diphosphatase (cis) Osmium Acid Golgi Rxn phosphatase (trans) (TGN)

Specific steps of oligosacc. processing occur in specific compartments 2nd F(x) Sorting of proteins

Two alternative Models to explain the transport of proteins thru the Golgi App.

Evidence: Vesicular Transport Panel 13-1.(study on your own) In a cell free system, isolated Golgi apps can exchange proteins by vesicular transport. Proteins from mutant Golgi lacking GlcNAc transferase I are able to have 3H-GlcNAc put on them by normal Golgi in the same tube. Cisternal Migration Some structures too large to fit into transport vesicles (collagen rods and algal scales) move progressively thru Golgi stacks. May be a combination of the two

Lysosomes are the sites of intracellular digestion.

Marking a lysosomal hydrolase with Mannose-6-P Then the GlcNAc is cleaved off, leaving M6P I-cell disease is due to a mutant GlcNAc Phosphotransferase

Transport of lysosomal enzymes to late endosomes, which become lysosomes.