SELF- REPLICATING ROBOTS. ABSTRACT Self reproduction is ultimate form of self repair. Self replication is generally considered to be a machine that can.

Slides:



Advertisements
Similar presentations
Developed by Reneta Barneva, SUNY Fredonia
Advertisements

WAREHOUSING MANAGEMENT
ARCHITECTURES FOR ARTIFICIAL INTELLIGENCE SYSTEMS
Ch:8 Design Concepts S.W Design should have following quality attribute: Functionality Usability Reliability Performance Supportability (extensibility,
Mike Marr Safety Consultant Specialist
The Decision-Making Process IT Brainpower
Chapter 5: Computer Systems Organization Invitation to Computer Science, Java Version, Third Edition.
INDUSTRIAL & SYSTEMS ENGINEERING (Lecture # 2). 2 Functional Groupings of I & SE o Work Measurement o Performance Rating o Time Standards o Motion Study.
Data Manipulation Computer System consists of the following parts:
HAS. Patterns The use of patterns is essentially the reuse of well established good ideas. A pattern is a named well understood good solution to a common.
Self-Replicating Distributed Virtual Machines Lance R. Williams Dept. of Computer Science University of New Mexico.
Von Neumann’s Automaton and Viruses Most slides taken from Weizmann Institute of Science and Rensselaer Polytechnic Institute.
James A. Senn’s Information Technology, 3rd Edition
ROBOT APPLICATIONS.
Victor Zykov, Efstathios Mytilinaios, Bryant Adams,Hod Lipson, Nature, 이영설 Self reproducing machines.
Signals and Systems March 25, Summary thus far: software engineering Focused on abstraction and modularity in software engineering. Topics: procedures,
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Invitation to Computer Science 5th Edition
CS 390- Unix Programming Environment CS 390 Unix Programming Environment Topics to be covered: Distributed Computing Fundamentals.
Chapter 5: Computer Systems Organization Invitation to Computer Science, Java Version, Third Edition.
CS 484 – Artificial Intelligence1 Announcements Lab 4 due today, November 8 Homework 8 due Tuesday, November 13 ½ to 1 page description of final project.
Computer Science Dept, San Jose State University, CA Self Reproducing CA’s and Programs Shruti Parihar May 06, 2003.
Chapter 1 “The Science of Biology” The goal of science is to investigate and understand, to explain events in nature, and to use those explanations to.
Part 3 Managing for Quality and Competitiveness © 2015 McGraw-Hill Education.
WHAT IS SCIENCE? WHAT IS SCIENCE? An organized way of gathering and analyzing evidence about the natural world.
WHAT IS SCIENCE? WHAT IS SCIENCE? An organized way of gathering and analyzing evidence about the natural world.
Computer Organization - 1. INPUT PROCESS OUTPUT List different input devices Compare the use of voice recognition as opposed to the entry of data via.
University of Windsor School of Computer Science Topics in Artificial Intelligence Fall 2008 Sept 11, 2008.
Introduction to IT Lecture – 01.
Artificial intelligence
Programming Paradigms Lecturer Hamza Azeem. What is PP ? Revision of Programming concepts learned in CPLB Learning how to perform “Object-Oriented Programming”
Finite State Machines (FSM) OR Finite State Automation (FSA) - are models of the behaviors of a system or a complex object, with a limited number of defined.
Question What technology differentiates the different stages a computer had gone through from generation 1 to present?
CMSC 104, Lecture 061 Stored Programs A look at how programs are executed.
System Model: Physical Module Constraints: 1)A module must have a minimum of two adjacent free sides in order to move. 2) A module must have an adjacent.
MODULAR SELF -RECONFIGURABLE MULTI-FUNCTIONAL ROBOTIC SYSTEM.
Robot Intelligence Technology Lab. Evolutionary Robotics Chapter 3. How to Evolve Robots Chi-Ho Lee.
SENSITIVE SKIN. OUTLINE INTRODUCTION SKIN MATERIALS DEVICES SIGNAL PROCESSING ADVANTAGES DISADVANTAGES APPLICATION CONCLUSION.
Chapter I: Introduction to Computer Science. Computer: is a machine that accepts input data, processes the data and creates output data. This is a specific-purpose.
Hardware and Software 6 th Grade Advanced Robotics 2.
Introduction to Machine Learning, its potential usage in network area,
Advanced Computer Systems
Unit 1 Days 1-2: Standard 1 Objective 1
Questions and Ponderings On “Life”
I/O SYSTEMS MANAGEMENT Krishna Kumar Ahirwar ( )
Fundamentals of Information Systems, Sixth Edition
CHAPTER 1 Introduction BIC 3337 EXPERT SYSTEM.
System Design Ashima Wadhwa.
OPERATIONS PROCESSES.
Chapter 2: System Structures
Objectives State the reasons for the complexity involved in the development of software Define the following terms Objects Classes Messages Methods Explain.
Lecture 2 of Computer Science II
1.#.
Programmable Logic Controllers (PLCs) An Overview.
CISC AND RISC SYSTEM Based on instruction set, we broadly classify Computer/microprocessor/microcontroller into CISC and RISC. CISC SYSTEM: COMPLEX INSTRUCTION.
Operating Systems Chapter 5: Input/Output Management
Theory of Computation Turing Machines.
Chapter 1 Introduction to Operating System Part 5
Goals of science: To investigate and understand the natural world
Chapter 5: Computer Systems Organization
Chapter 2: Computer Hardware
Outline Chapter 2 (cont) OS Design OS structure
Introduction to Computer Programming
System calls….. C-program->POSIX call
Introduction to Robotics
Von Neumann’s Automaton and Viruses
Chapter 1 “The Science of Biology”
ERP and Related Technologies
Presentation transcript:

SELF- REPLICATING ROBOTS

ABSTRACT Self reproduction is ultimate form of self repair. Self replication is generally considered to be a machine that can build itself, and that they can build another copy and so on. The self reproducing machines demonstrated here are essentially modular robots, consisting of multiple identical actuated modules with electromagnets to selectively weaken and strengthen connections.The cubes are powered at the base and transfer data and power through their faces. The control of machine is distributed among the modules executes a motion schedule governed by time and contact events. The sides also have electromagnets that enable them to selectively attach and detach from each other. The modular robot can thus reconfigure itself. And in each block is a small computer chip which is programmed with step-by-step instructions about what to do. It is a small step towards developing robots that can repair and replicate themselves in space or hazardous environments

DEFINITION OF ROBOTICS: Robotics is the science and technology of how robots are made and function via electronic and mechanical processes. It is also about understanding the software applications that control their movements. Robots are essentially machines that perform tasks.

SELF REPLICATING ROBOTS : DEFINITION : Self-replication is the process by which a thing may act, and thereby make a copy of itself. Biological cells, given suitable environments, reproduce by cell division. During cell division, DNA is replicated and can be transmitted to offspring during reproduction.. Computer viruses reproduce using the hardware and software already present on computers.Biological cellscell divisionDNA reproductionComputer viruses A self-replicating machine is, as the name suggests, an artificial self-replicating system that relies on conventional large-scale technology and automation.self-replicating

 It is unlikely that this would all be contained within a single monolithic structure, but would rather be a group of cooperating machines that is capable of manufacturing all of the machines.monolithic  The factory needs production of mining robots to collect raw materials, construction robots to put new machines together, and repair robots to maintain itself against wear and tear, all without human intervention or direction.robots  Self-replicating machine needs the capacity to gather energy and raw materials, process the raw materials into finished components, and then assemble them into a copy of itselfraw materials  The advantage of such a system lies in its ability to expand its own capacity rapidly and without additional human effort.

 Self-replicating machine needs the capacity to gather energy and raw materials, process the raw materials into finished components, and then assemble them into a copy of itselfraw materials  The advantage of such a system lies in its ability to expand its own capacity rapidly and without additional human effort.

SELF REPLICATING MACHINES REQUIRE: Construction materials Manufacture of new parts Consistent power source Programming the new members

Theory : Research by John von Neumann established that one common form of a replicator has several parts:John von Neumann  A genome, a compact, usually error-resistant representation of the replicator's stored algorithm. Biologically, this is DNA.DNA  A specialized set of mechanisms to copy and repair the genome, using resources gathered by the body. Biologically, this is something like transcriptase. transcriptase  A body, which gathers resources and energy, and interprets a stored algorithm. Biologically, these are ribosomes.ribosomes

A self-reproducing computer program In computer science a self-reproducing computer program is a computer program, that, when executed, outputs its own code. An example in the Python programming language :computer sciencePython programming language a='a=%s;print a%`a`';print a%`a`

CLASSIFICATION OF SELF REPLICATING ROBOTS : Recent research has begun to categorize replicators, based on the amount of support they require. Natural replicators have all or most of their design from nonhuman sources. Such systems include natural life forms. Autotrophic replicators can reproduce themselves "in the wild". They mine their own materials. It is conjectured that non-biological autotrophic replicators could be designed by humans, and could easily accept specifications for human products.Autotrophic Self-reproductive systems are conjectured systems which would produce copies of themselves from industrial feedstocks such as metal bar and wire. Self-assembling systems are assemble copies of themselves from finished, delivered parts.

Design consideration The design phase of the replicators is very broad. A comprehensive study to date has identified 137 design dimensions grouped into a dozen separate categories, including: (1) Replication Control, (2) Replication Information, (3) Replication Substrate, (4) Replicator Structure, (5) Passive Parts, (6) Active Subunits, (7) Replicator Energetics, (8) Replicator Kinematics, (9) Replication Process, (10) Replicator Performance, (11) Product Structure, and (12) Evolvability.

Construction:  A self replicating robot which has been developed recently contains a series of modular cubes called "molecubes" each containing identical machinery and the complete computer program for replication.

The cubes have electromagnets on their faces that allow them to selectively attach to and detach from one another, and a complete robot consists of several cubes linked together. Each cube is divided in half along a long diagonal, which allows a robot composed of many cubes to bend, reconfigure and manipulate other cubes. For example, a tower of cubes can bend itself over at a right angle to pick up another cube.

Base plate that supplies energy to cubes.

 By repeating the process, one robot made up of a stack of cubes can create another just like itself. Since one robot cannot reach across another robot of the same height, the robot being built assists in completing its own construction. WORKING PRINCIPLE:  Then it bends to one side or another to pick up a new cube and deposit it on top of the first  Replication starts with, the stack of cubes bending over and sets its top cube

APPLICATIONS OF THE SELF REPLICATING ROBOTS Terrestrial Applications: An Intelligent Earth-Sensing Information System Terrestrial Applications: An Intelligent Earth-Sensing Information System A new primitive cell state in the system to permit signals to cross without interference called "wire-crossing" organ can be devised using only the self replicating cell types A new primitive cell state in the system to permit signals to cross without interference called "wire-crossing" organ can be devised using only the self replicating cell types Studies of the flow of excitation in heart tissue, the dispersal of medicinal drugs, and pattern recognition Studies of the flow of excitation in heart tissue, the dispersal of medicinal drugs, and pattern recognition Cell spaces also have been investigated as abstract mathematical objects where one tries to determine whether from every mathematical pattern all other patterns can be attained, and whether there are some patterns not attainable at all by means of the transition function, and various other specialized questions. Cell spaces also have been investigated as abstract mathematical objects where one tries to determine whether from every mathematical pattern all other patterns can be attained, and whether there are some patterns not attainable at all by means of the transition function, and various other specialized questions.

CONCLUSION Self-reproduction is the ultimate form of self- repair. We see that robotic systems are becoming more complex, and in some cases like space exploration, they need to sustain operation for long periods of time without human assistance. Self-reproduction is the ultimate form of self- repair. We see that robotic systems are becoming more complex, and in some cases like space exploration, they need to sustain operation for long periods of time without human assistance. If you send a robot to Mars, for example, and it breaks, there is little you can do. But if instead of sending a fixed robot you send a robot with a supply of modules, then that robot may be able to self-repair and even make more and possibly different robots if the mission needs change unexpectedly. If you send a robot to Mars, for example, and it breaks, there is little you can do. But if instead of sending a fixed robot you send a robot with a supply of modules, then that robot may be able to self-repair and even make more and possibly different robots if the mission needs change unexpectedly.