DNA replication and Protein synthesis.

DNA (Deoxyribonucleic Acid)

Genetic material of cells… GENES – units of genetic material that CODES FOR A SPECIFIC TRAITGENES – units of genetic material that CODES FOR A SPECIFIC TRAIT Called NUCLEIC ACIDSCalled NUCLEIC ACIDS DNA is made up of repeating molecules called NUCLEOTIDESDNA is made up of repeating molecules called NUCLEOTIDES

DNA Nucleotide O O=P-O OPhosphate Group Group N Nitrogenous base (A, G, C, or T) (A, G, C, or T) CH2 O C1C1 C4C4 C3C3 C2C2 5 Sugar Sugar(deoxyribose)

A HISTORY OF DNA DNA double helixDiscovery of the DNA double helix A. Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria (1928) B.Rosalind Franklin - X-ray photo of DNA. (1952) C.Watson and Crick - described the DNA molecule from Franklin’s X-ray. (1953)

Watson & Crick proposed… DNA had specific pairing between the nitrogen bases:DNA had specific pairing between the nitrogen bases: ADENINE – THYMINE CYTOSINE - GUANINE DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule”DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule”

DNA Double Helix Nitrogenous Base (A,T,G or C) “Rungs of ladder” “Legs of ladder” Phosphate & Sugar Backbone

Nitrogenous Bases PURINESPURINES Adenine (A) 1.Adenine (A) Guanine (G) 2.Guanine (G) PYRIMIDINESPYRIMIDINES Thymine (T) 3.Thymine (T) Cytosine (C) 4.Cytosine (C) T or C A or G

Chargaff’s Rule Adenine ThymineAdenine must pair with Thymine GuanineCytosineGuanine must pair with Cytosine about the sameTheir amounts in a given DNA molecule will be about the same. G C TA

Genetic Diversity… Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms.Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms.

The Code of Life… The “code” of the chromosome is the SPECIFIC ORDER that bases occur.The “code” of the chromosome is the SPECIFIC ORDER that bases occur. A T C G T A T G C G G…

DNA is wrapped tightly around histones and coiled tightly to form chromosomes See p. 297

DNA Replication Replication = Duplication –Happens in the S phase of Interphase –Must replicate before mitosis or meiosis I Part of the double helix is unwound Replication in small pieces (Okazaki fragments) Enzyme stitches pieces together later

DNA Replication DNA must be copiedDNA must be copied The DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A- T, G-CThe DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A- T, G-C Each strand of the original DNA serves as a template for the new strandEach strand of the original DNA serves as a template for the new strand

Semi-Conservative Replication One-half of each new molecule of DNA is old (template strand) One-half of new molecule of DNA is new (complementary strand)

DNA Replication Semiconservative Model:Semiconservative Model: Watson and Crick showed: 1.Watson and Crick showed: the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand.. Parental DNA DNA Template New DNA

What is a Gene? A length of DNA on a chromosome May be in several parts –Exon – the expressed parts of the DNA sequence –Intron – the intervening, “junk DNA”, not expressed Parts are cut, put together and then used to make RNA and proteins

DNA Transcription DNA can “unzip” itself and RNA nucleotides match up to the DNA strand.DNA can “unzip” itself and RNA nucleotides match up to the DNA strand. Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.

DNA Transcription & Protein Translation Honors Biology SOL.BIO.6f

DNA Transcription DNA must be copied to messenger RNA (mRNA) mRNA goes from nucleus to the ribosomes in cytoplasm mRNA complements known as codons –Only 3 nucleotide “letters” long Remember RNA has uracil (U) instead of thymine (T)!

Transcription – Step I A C G T A T C G C G T A T G C A T A G C G C A T Template DNA Strands

Transcription – Step II A C G T A T C G C G T A U G C A U A G C G C A U Template DNA is Matched Up with Complementary mRNA Sequences

Transcription – Step III mRNA leaves nucleus and goes to ribosomes U G C A U A G C G C A U A new complementary RNA strand is made (rRNA) A C G U A U C G C G U A

Transcription Reminders The template strand is the DNA strand being copied The rRNA strand is the same as the DNA strand except Us have replaced Ts

Protein Translation Modified genetic code is “translated” into proteins Codon code is specific, but redundant! –20 amino acids –64 triplet (codon) combinations

tRNA in cytoplasm has a codon attached to an amino acid

tRNA structure 3-base code (triplet) is an “anticodon” Protein molecule Attached amino acid that is carried from cytoplasm to ribosomes

RNA AND PROTEIN SYNTHESIS

How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 3 phases3 phases: 1.Transcription 2.RNA processing 3.Translation DNA  RNA  ProteinDNA  RNA  Protein

DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

Before making proteins, Your cell must first make RNA Question:Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

1. Transcription DNA strands RNAThen moves along one of the DNA strands and links RNA nucleotides together. Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

1. Transcription OR RNA production RNA molecules are produced by copying part of DNA into a complementary sequence of RNA This process is started and controlled by an enzyme called RNA polymerase.

1. Transcription DNApre-mRNA RNA Polymerase

Question: RNA DNAWhat would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’

Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) Remember: all produced in the nucleus!Remember: all produced in the nucleus!

mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an from the principal to the cafeteria lady.

A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

rRNA Part of the structure of a ribosome Helps in protein production tRNA Gets the right amino acids to make the right protein according to mRNA instructions

B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

2. RNA Processing Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

2. RNA Processing IntronsexonsIntrons are pulled out and exons come together. mature RNA molecule nucleuscytoplasm.End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good!Introns bad…… Exons good!

2. RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

3. Translation - making proteins Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG)

3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

Protein Synthesis Start: Ribosome binds to mRNA at start codon (AUG) Elongation: –tRNA complexes bind to mRNA codon by forming complementary base pairs with the tRNA anticodon –The ribosome moves from codon to codon along the mRNA. –Amino acids are added one by one Release: release factor binds to the stop codon

Protein packaging Secretory vesicles Secreted to E C F Golgi Apparatus

Figure 3-11: The Golgi apparatus

Lysosomes –Enzymes –Intracellular digestion Peroxisomes –Hydrogen peroxide –Detoxification –Fatty acid degradation Cytoplasmic Vesicles Figure 3-12: Lysosomes and peroxisomes