University of Delhi South Campus Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad National Centre for Plant Genome Research Debasis Chattopadhyay Sabhyata Bhatia Indian Initiative on Tomato Genome Sequencing Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region UDSC & NCPGR NRCPB (0-60 cM) ( cM)

Criteria for BAC selection and confirmation 1.Selection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN 4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers 2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies 3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs 5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA 6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker: CT101 Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG L. esculentum L. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5 Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82)

cMMarkerAmpli- con size HaplotypesSequence 0CT bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 3T bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 GAATGAAT L. pennellii, IL5-1 7C2At1g bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 TAGATATGGT CTACCGA-AC L. pennellii, IL cLET-8-B23 (BAC-specific, non-marker region) 360 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACT AAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTA L. pennellii, IL5-1 12T bp M82, IL5-1, IL5-2, IL5- 3, IL5-4, IL5-5 GA--A AGTTG L. pennellii 15.5cLED-8-G31000 bp M82, IL5-2, IL5-3, IL5- 4, IL5-5 CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAA TGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACT L. pennellii, IL5-1 Confirmation of markers and their assigned seed BAC positions on chromosome 5

BAC/MarkerAmplico n size HaplotypesSequence LE_HBa0179K0 9 SP6 ext. 750 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 TACGTG...TTATGACT CGAACAI/DGACAATAG L. pennellii, IL7-2 T bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09 GA--A AGTTG L. pennellii, IL7-2 LE_HBa0179K0 9 T7 ext. 550 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 ACC GTA L. pennellii, IL7-2 SL_MboI0032F0 7 SP6 ext. 700 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032f07 TCTC...TC...GG...AGTG- TGGAAG ATCAI/DCAI/DTAI/DGA-AT- TTTCA L. pennellii, IL7-2 Reallocation of marker T0876 and its associated BAC positions on chromosome 7

SP6 T7 SP6 T7 SP6 T7 HBa0179K09 (108 kb) MboI0032F07 (~140 kb) MboI0052O23 MboI0083J01 MboI0077G20 (92 kb) SP bp overlap (100%) bp overlap (100%) HBa0188L22 HBa0064M20 HBa0102G23 HBa0123J08 HBa0144B20 ~3.5 kb overlap ~1.4 kb overlap Primer pair 1 Primer pair 2 Primer pair 1 Primer pair 2 ~19 kb overlap ~15.5 kb overlap Chromosome 7 T1401 (COS) CT223 (RFLP) 95 cM Clones sequenced to Phase III level Clones sequenced to Phase II level Extension clones verified Red bars indicate the PCR positive nature of BAC clones using respective primer pairs Dotted line indicates the expected overlap Blue line shows the presence of mapped markers on the BAC clones BACs mapped on chromosome 7

Single streak of BAC clones from seed BAC library DNA extraction PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end- sequence database DNA fingerprinting (HindIII-digested) for BAC stock purity The path for genomic sequencing 1 TACGTG...TTAT 2 CGAACAI/DGACA IL-mapping for chromosome 5-specificity Polymorphism in PCR (digested) products presence of SNP/indels Assembly of sequence BAC annotation Overgo hybridization Selection of extension BAC Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1

Total LE_HBa0245E LE_HBa0251J LE_HBa0239D LE_HBa0108A LE_HBa0006N LE_HBa0131D LE_HBa0040C LE_HBa0166A LE_HBa0334K LE_HBa0169M SL_MboI0077G LE_HBa0179K LE_HBa0042B LE_HBa0261K LE_HBa0191B011 No. of genesUnknownExpressedPutativeKnownClone name S. No. Gene prediction of some BAC clones (by FGENESH)

Functional annotation of some BAC clones KNOWN PUTATIVE EXPRESSED UNKNOWN

Important genes present on some BAC clones S. No.BAC cloneName of the geneOrganism 1HBa0191B01Putative cytochrome P450O. sativa 2HBa0191B01HAC1 transcription factorA. thaliana 3HBa0051A13Peroxisomal acyl-CoA oxidase 1AL. cheesmanii 4HBa0051A139-cis –epoxycarotenoid dioxygenaseL. esculentum 5MboI0005B15ATP-binding protein At1g60440L. esculentum 6MboI0005B15Pantothenate kinase family proteinL. esculentum 7HBa0261K11Putrescine aminopropyltransferaseL. esculentum 8HBa0261K11 Splicing factor PWI containing protein/ RNA recognition motif L. esculentum 9HBa0042B19Beta fructosidase geneL. pennellii 10HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum 11HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum 12HBa0179E24 Eukaryotic translation initiation factor 5A- 3 L. esculentum 13MboI0037H06 Potyviral capsid protein interacting protein 2a (CPIP2a) N. tabacum 14MboI0037H06UV-damaged DNA binding protein 1 (hp1)L. cheesmanii

Highlights 5. Current status of BAC clones from chromosome 5, selected for sequencing * Six finished BAC clones (5 submitted to NCBI) * Nineteen BAC clones in phase II (11 submitted to NCBI) * Thirteen BAC clones in phase I * Six BAC clones at various stages of library preparation and sequencing 4. Finally, 44 BAC clones, covering approximately ~4.4 Mb region, have been mapped 3. Additional twenty one extension BAC clones have also been confirmed 2. Twenty three seed BAC clones have been confirmed 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI 7. Six BAC clones have been sent for FISH

Physical map: issues ChromosomeBAC clones

L. esculentum IL 5-2 L. pennellii IL 5-1 L. pennelliiIL 5-1IL 5-2 (M82) SNP-based analyses for confirmation of introgressed fragment of L. pennellii in IL5-2

L. pennellii L. esculentum IL-5-2 Marker T0619 (59cM) Confirmation of introgressed fragment of L. pennellii in IL5-2 L. pennelliiIL 5-1IL 5-2 (M82)