Kathleen Brundage, Ph.D. Director West Virginia University Flow Cytometry & Single Cell Core Facility Enrichment of CRISPR-mediated Homologous-Directed Repair in Mammalian Cells by Cell Cycle-based Flow Sorting

Non-homologous End Joining (NHEJ) Homology Directed Repair (HDR) Deletions Insertions Nuclease-induced Gene Editing Donor Template HDR Various lengths Precise insertion or modification

Problem NHEJ out competes HDR because NHEJ occurring throughout cell cycle, whereas HDR takes place only during S and G2 phases. Question: How to increase/enrich for cells undergoing HDR? Potential solutions 1. Synchronize the cell cycle of the cell population 2. Block the NHEJ pathway using chemicals 3. Used additional DNA vectors 4. Cell cycle based Flow Cytometry Sorting method to enrich for cells undergoing HDR

Acknowledgements Research Flow Cytometry Core Monica DeLay Sherry Thornton Transgenic Animal and Genomic Editing Core Huirong Xie Yinhaui Chen Yueh-Chiang Hu Cincinnati Children’s Hospital

CRISPR/Cas9-mediated knock-in in mouse ESCs CBh SpCas9 2A-GFP U6-sgRNA pA CTCTGCTAACTCATCTCAGG pX458-Dazl Construct Single guide RNA (sgRNA) Targets the stop codon (TAA) in the mouse Dazl gene Ex 11 P2A-tdTomato 3’UTR Designed to insert P2A-tdTomato at the end of the Dazl coding sequence Donor Plasmid 2.9 Kb2 Kb

Ex 11 P2A-tdTomato 3’UTR Desired Result Dazl locus Ex 11 3’UTR Ex 11 P2A-tdTomato 3’UTR Donor plasmid pX458-Dazl Dazl locus

Validation of the HDR Reporter System 1.Electroporation of mouse ESCs with pX458-Dazl and the circular donor plasmid using the NEON system (Life Technologies) 2.Single cells were plated and cultured for 8 days 3.9 of the tdTomato (+) mouse ESCs were genotyped 4.All where shown to be correctly targeted Correctly targeted clone BrightfieldtdTomato Negative clone tdTomato Brightfield

Donor pX458- Dazl Cells + CRISPR/Cas9 5 hours Hoechst  g/ml 30 min Sort GFP(+) Cell Cycle BD FACSAria II 100 micron nozzle 20 psi 1 x 10 6 cells/ml GFPs expression detected Experimental Design

Sorting Strategy 30% Sorted Populations G1SG2

A. 5,000 cells from an asynchronous population and from each cell cycle fraction were sorted into 60-mm dishes B. After 8-10 days in culture, the percent of tdTomato(+) cells was evaluated by flow cytometry. Does cell cycle status at the beginning of sgRNA/Cas9 expression affect HDR Efficiency? Cells Analyzed For dTomato On BD FACSCanto

Percent of dTomato(+) cells

Stage Number of Surviving clones from 3 plates Percent Survival Number of tdTomato(+) clones from 3 plates Percent HDR G %26.9% S4314.9%920.9% G2/M144.9%214.3% 1.Sorted single mouse ESCs from each cell cycle fraction into three 96-well plates 2.Cultured the sorted cells for 10 days. 3.Determined cell survival and tdTomato expression using a flurorescence microscope. Can sorting cells based on cell cycle stage be used for cell targeting and cloning?

Cell Cycle Stage Does GFP expression level have a role in inducing cell death during clonal growth? Index sorting to identify the corresponding events in each well

Conclusions 1.At the start of sgRNA/Cas9 expression, cell cycle status affects the frequency of HDR in cells. Cells in S phase have the highest chance of entering the HDR pathway (2~3 times higher than G1-sorted cells). 2.A simple, cell cycle-based FACS sorting method can be used to significantly enrich cells undergoing HDR, following CRISPR/Cas9 targeting providing a more efficient selection of precisely targeted cell populations. 3.High GFP expression decreases the frequency of HDR and cell viability.

Future Direction 1.ESCs are fast-proliferating cells that have a shorter G1 phase. The plan is to test a wide variety of slow-proliferating cells that stay longer in G1 phase. The expectation is that this method dramatically improve the frequency of cells undergoing HDR. 2.Test additional DNA binding dyes such as DyeCycle Dyes (eg. Violet or Ruby) to allow flexibility in the type of laser needed to perform the cell sort.

Acknowledgements Cincinnati Children’s Research Foundation for support of the Gene Editing Core and Research Flow Cytometry Cores involved in this project. Cores are supported by NIH DK78392 and NIH AR Research Flow Cytometry Core Monica DeLay Sherry Thornton Transgenic Animal and Genomic Editing Core Huirong Xie Yinhaui Chen Yueh-Chiang Hu Cincinnati Children’s Hospital