How Genes Work: From DNA to RNA to Protein Chapter 17

Figure 17.6 (a) Tobacco plant expressing a firefly gene gene (b) Pig expressing a jellyfish

Types of RNA

Steps to Proteinsynthesis 1.Transcription- DNA to mRNA 2.RNA Processing- remove noncoding segments 3.Translation- mRNA to tRNA to Amino Acid Sequence

Complementary Base Pairing A=UT=AC=GG=CA=UT=AC=GG=C DNA Nitrogen Bases RNA Nitrogen Bases The code travels from DNA to mRNA to tRNA to protein.

Complementary Base Pairing A=UU=AC=GG=CA=UU=AC=GG=C mRNA Nitrogen Bases tRNA Nitrogen Bases The code travels from DNA to mRNA to tRNA to protein.

Figure 17.4 DNA template strand TRANSCRIPTION mRNA TRANSLATION Protein Amino acid Codon Trp Phe Gly 5 5 Ser UUUUU G G GGCC T C A A AAAAA TTT T T G GGG CCC GG DNA molecule Gene 1 Gene 2 Gene 3 C C

Figure 17.3b-1 Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell TRANSCRIPTION

Figure 17.3b-2 RNA PROCESSING Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell mRNA TRANSCRIPTION

Figure 17.3b-3 RNA PROCESSING Nuclear envelope DNA Pre-mRNA (b) Eukaryotic cell mRNA TRANSCRIPTION TRANSLATION Ribosome Polypeptide

Initiation Complex Single binding protein Replication Fork Initiation Complex Initiation Complex

RNA Polymerase 5’ 3’ 5’ 3’ 5’ 3’ Promoter Terminator RNA Polymerase Initiation Complex Initiation Complex

Pre-mRNA DNA recoils

Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure RNA processing: RNA splicing TRANSCRIPTION RNA PROCESSING DNA Pre-mRNA mRNA TRANSLATION Ribosome Polypeptide 5 Cap Exon Intron Exon Intron Exon 3 Poly-A tail Introns cut out and exons spliced together Coding segment 5 Cap UTR Pre-mRNA mRNA

Figure RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins

Figure RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins Spliceosome 5

Figure RNA transcript (pre-mRNA) 5 Exon 1 Protein snRNA snRNPs Intron Exon 2 Other proteins Spliceosome 5 Spliceosome components Cut-out intron mRNA 5 Exon 1 Exon 2

Gene DNA Exon 1 Exon 2Exon 3 Intron Transcription RNA processing Translation Domain 3 Domain 2 Domain 1 Polypeptide Figure 17.13

Figure Polypeptide Ribosome Trp Phe Gly tRNA with amino acid attached Amino acids tRNA Anticodon Codons UUUUGGGGC A C C C C G AAA C G C G 5 3 mRNA

Figure Amino acid attachment site 3 5 Hydrogen bonds Anticodon (a) Two-dimensional structure (b) Three-dimensional structure (c) Symbol used in this book Anticodon 3 5 Hydrogen bonds Amino acid attachment site 5 3 AAG

Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP Figure

Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine Figure

Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine tRNA Adenosine P tRNA AMP Computer model Amino acid Aminoacyl-tRNA synthetase Figure

Aminoacyl-tRNA synthetase (enzyme) Amino acid PPP Adenosine ATP P P P P P i i i Adenosine tRNA Adenosine P tRNA AMP Computer model Amino acid Aminoacyl-tRNA synthetase Aminoacyl tRNA (“charged tRNA”) Figure

Figure 17.17b Exit tunnel A site (Aminoacyl- tRNA binding site) Small subunit Large subunit P A P site (Peptidyl-tRNA binding site) mRNA binding site (b) Schematic model showing binding sites E site (Exit site) E

Figure 17.17c Amino end mRNA E (c) Schematic model with mRNA and tRNA 5 Codons 3 tRNA Growing polypeptide Next amino acid to be added to polypeptide chain

Figure Initiator tRNA mRNA Start codon Small ribosomal subunit mRNA binding site 3 Translation initiation complex U U A A G C P P site i  GTPGDP Met Large ribosomal subunit EA 5

Amino end of polypeptide mRNA 5 E P site A site 3 Figure

Amino end of polypeptide mRNA 5 E P site A site 3 E GTP GDP  P i P A Figure

Amino end of polypeptide mRNA 5 E P site A site 3 E GTP GDP  P i P A E P A Figure

Amino end of polypeptide mRNA 5 E A site 3 E GTP GDP  P i P A E P A GTP GDP  P i P A E Ribosome ready for next aminoacyl tRNA P site Figure

Figure Release factor Stop codon (UAG, UAA, or UGA) 3 5

Figure Release factor Stop codon (UAG, UAA, or UGA) Free polypeptide 2 GTP 2 GDP  2 i P

Figure Release factor Stop codon (UAG, UAA, or UGA) Free polypeptide 2 GTP GDP  2 i P

mRNA Codon Chart DNA – T A C G G G T C G A T A A T T mRNA – A U G C C C A G C U A U U A A AA Sequence – Met-Pro-Ser-Tyr-Stop

DNA = AGCTTACGGGATAACTCCC mRNA = AUGCCCUAUUGA Met-Pro-Tyr-Stop

BIOLOGY PRACTICE PROTEINSYNTHESIS 3’ ACGGCTACGGGCTTCGAAAAACTCACACA 5’ 5’ ACACAATTAGGATCCAAACATCACTGGAC 3’

BIOLOGY PRACTICE PROTEINSYNTHESIS 3’ ACGGCTACGGGCTTCGAAAAACTCACACA 5’ 5’ AUGCCCGAAGCUUUUUGAGUGUGU3’ Met-Pro-Glu-Ala-Phe-Stop 5’ ACACAATTAGGATCCAAACATCACTGGAC 3’ 3’ UGUGUUAAUCCUAGGUUUGUA 5’ Met-Phe-Gly-Ser-Stop

Figure 17.5 Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon) UUU UUC UUA CUU CUC CUA CUG Phe Leu Ile UCU UCC UCA UCG Ser CCU CCC CCA CCG UAU UAC Tyr Pro Thr UAA Stop UAG Stop UGA Stop UGU UGC Cys UGG Trp GC U U C A U U C C C A U A A A G G His Gln Asn Lys Asp CAU CGU CAC CAA CAG CGC CGA CGG G AUU AUC AUA ACU ACC ACA AAU AAC AAA AGU AGC AGA Arg Ser Arg Gly ACGAUG AAG AGG GUU GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Val Ala GGU GGC GGA GGG Glu Gly G U C A Met or start UUG G

Figure Completed polypeptide Incoming ribosomal subunits Start of mRNA (5 end) End of mRNA (3 end) (a) Polyribosome Ribosomes mRNA (b) 0.1  m Growing polypeptides

Gene Mutations Changes in the base sequence of a single gene

Point Mutation Mutation involving the substitution of one base.

NormalSickle

Frameshift Mutation Mutation involves a change in the reading frame of the codon. Example: Deletion

The Rock Pocket Mouse