Protein Synthesis Making Proteins DNAmRNA tRNA Protein

 DNA has the information to build proteins  Genes - DNA coding sections DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work

How do proteins do all the work Proteins proteins run living organisms Enzymes – protein catalysts control all chemical reactions in living organisms structure all living organisms are built out of proteins

Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome nucleus cytoplasm ribosome build proteins

mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein

DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Transcribing DNA Double stranded DNA unzips at Gene Helicase is the enzyme that does the unzipping AGGGGGGTTACACTTTTTCCCCAA Helicase

Matching bases of DNA & RNA Matching RNA bases, floating in nucleus, connect to DNA bases on one of the DNA strands RNA Polymerase is the enzyme that attaches them together U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for amino acids in triplets (codons) amino acids will combine to form Proteins TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon = block of 3 mRNA bases codon ribosome amino acids (aa)

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU C aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

mRNA to protein = Translation The tRNA goes back into the cytoplasm, to pick up another amino acid. The amino acid chain is left to become the functioning Protein. mRNA amino acid chain cytoplasm

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa

For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

From gene to protein transcription translation protein

From gene to protein to YOU cytoplasm aa mRNA DNA transcription nucleus protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa

It’s Growth for Protein Synthesis! It’s Repair It’s YOU