Protein Synthesis Making Proteins DNAmRNA tRNA Protein
DNA has the information to build proteins Genes - DNA coding sections DNA Proteins Cells Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work
How do proteins do all the work Proteins proteins run living organisms Enzymes – protein catalysts control all chemical reactions in living organisms structure all living organisms are built out of proteins
Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome nucleus cytoplasm ribosome build proteins
mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein
DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded
Transcribing DNA Double stranded DNA unzips at Gene Helicase is the enzyme that does the unzipping AGGGGGGTTACACTTTTTCCCCAA Helicase
Matching bases of DNA & RNA Matching RNA bases, floating in nucleus, connect to DNA bases on one of the DNA strands RNA Polymerase is the enzyme that attaches them together U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A
Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA
AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for amino acids in triplets (codons) amino acids will combine to form Proteins TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? Codon = block of 3 mRNA bases codon ribosome amino acids (aa)
mRNA to protein = Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU C aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome
mRNA to protein = Translation The tRNA goes back into the cytoplasm, to pick up another amino acid. The amino acid chain is left to become the functioning Protein. mRNA amino acid chain cytoplasm
How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa
For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG The mRNA code
From gene to protein transcription translation protein
From gene to protein to YOU cytoplasm aa mRNA DNA transcription nucleus protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa
It’s Growth for Protein Synthesis! It’s Repair It’s YOU