Mutation Genetics-II MSc Botany 3 rd semester Dr Habib-ur-Rehman Athar Institute of Pure and Applied Biology Bahauddin Zakariya University Multan 60800, Pakistan

INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic variations On the positive side, mutations are the foundation for evolutionary change E.g. Light skin in high latitude human populations On the negative side, mutations are the cause of many diseases E.g. Hemophilia

DNA Maintenance Mutation rate are extremely low 1 mutation out of 10 9 nucleotides per generation

Mutations can be divided into three main types 1. Chromosome mutations Changes in chromosome structure 2. Genome mutations Changes in chromosome number 3. Single-gene mutations Relatively small changes in DNA structure that occur within a particular gene Types 1 and 2 will be discussed later Type 3 will be discussed in this set of lecture notes 16.1 CONSEQUENCES OF MUTATIONS

A point mutation is a change in a single base pair It involves a base substitution Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’ A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine A transversion is a change of a pyrimidine to a purine or vice versa Transitions are more common than transversions

Mutations may also involve the addition or deletion of short sequences of DNA Gene Mutations Change the DNA Sequence 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCTC 3’ 3’ TTGCGAG 5’ 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’ Deletion of four base pairs Addition of four base pairs

Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide Due to the degeneracy of the genetic code E.g. AUU to AUC still codes for Ile Missense mutations are those base substitutions in which an amino acid change does occur Example: Sickle-cell anemia If the substituted amino acid does not affect protein function (as measured by phenotype), the mutation is said to be neutral Gene Mutations Can Alter the Coding Sequence Within a Gene

Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Gene Mutations Can Alter the Coding Sequence Within a Gene Nonsense mutations are those base substitutions that change a normal codon to a termination codon Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation Table 16.1 describes all of the above mutations

In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele) A forward mutation changes the wild-type genotype into some new variation If it is beneficial, it may move evolution forward Otherwise, it will be probably eliminated from a population A reverse mutation has the opposite effect It is also termed a reversion Gene Mutations and Their Effects on Genotype and Phenotype

Mutations can also be described based on their effects on the wild-type phenotype When a mutation alters an organism’s phenotypic characteristics, it is said to be a variant Variants are often characterized by their differential ability to survive Deleterious mutations decrease the chances of survival The most extreme are lethal mutations E.g. Homozygous polydactyly in cats Beneficial mutations enhance the survival or reproductive success of an organism Some mutations are called conditional mutants They affect the phenotype only under a defined set of conditions

A second mutation will sometimes affect the phenotypic expression of another These second-site mutations are called suppressor mutations or simply suppressors Suppressor mutations are classified into two types Intragenic suppressors The second mutant site is within the same gene as the first mutation Intergenic suppressors The second mutant site is in a different gene from the first mutation

These mutations can still affect gene expression A mutation, may alter the sequence within a promoter Up promoter mutations make the promoter more like the consensus sequence They may increase the rate of transcription Down promoter mutations make the promoter less like the consensus sequence They may decrease the rate of transcription Probably responsible for most differences between closely- related organisms (e.g. humans and chimps) A mutation can also alter splice junctions in eukaryotes Refer to Table 16.2 for other examples Gene Mutations in Non-coding Sequences

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-13

Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next These diseases include Huntington disease (HD) Fragile X syndrome (FRAXA) Refer to Table 16.3 for these and other examples Mutations Due to Trinucleotide Repeats

Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted from parent to offspring without mutation However, in persons with TRNE disorders, the length of a trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n = 18

In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease In other cases, the expansions are located in noncoding regions of genes These expansions are hypothesized to cause abnormal changes in RNA structure Thereby producing disease symptoms

A chromosomal rearrangement may affect a gene because the break occurred in the gene itself A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect There are two common reasons for position effects: 1. Movement to a position next to regulatory sequences Refer to Figure 16.2a 2. Movement to a position in a heterochromatic region Refer to Figure 16.2b AND 16.3 Changes in Chromosome Structure Can Affect Gene Expression

Figure 16.2 Regulatory sequences are often bidirectional

Geneticists classify the animal cells into two types Germ-line cells Cells that give rise to gametes such as eggs and sperm Somatic cells All other cells Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells Refer to Figure 16.4a Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells Refer to Figure 16.4b AND 16.5 Mutations Can Occur in Germ-Line or Somatic Cells

Figure 16.4 Therefore, the mutation can be passed on to future generations The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations

Mutations can occur spontaneously or be induced Spontaneous mutations Result from abnormalities in cellular/biological processes Errors in DNA replication, for example Induced mutations Caused by environmental agents Agents that are known to alter DNA structure are termed mutagens These can be chemical or physical agents Refer to Table OCCURRENCE AND CAUSES OF MUTATION

Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked themselves for a long time Jean Baptiste Lamarck Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring Charles Darwin Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms Spontaneous Mutations Are Random Events

These two opposing theories of the 19th century were tested in bacteria in the 1940s and 1950s Salvadore Luria and Max Delbruck studied the resistance of E. coli to bacteriophage T1 ton r (T one resistance) They wondered if ton r is due to spontaneous mutations or to a physiological adaptation that occurs at a low rate? The physiological adaptation theory predicts that the number of ton r bacteria is essentially constant in different bacterial populations The spontaneous mutation theory predicts that the number of ton r bacteria will fluctuate in different bacterial populations Their test therefore became known as the fluctuation test

The Luria-Delbruck fluctuation test Figure 16.6 E.. coli is grown in the absence of T1 phages Plates containing T1 phages Great fluctuation in the number of ton r coloniesRelatively even distribution of ton r colonies Many ton r bacteria Mutation occurred at an early stage of population growth, before T1 exposure No ton r bacteria Spontaneous mutation did not occur These are mixed together in a big flask to give an average value of ton r cells Prediction if mutation occurred randomly prior to plating Prediction if exposure to T1 induced mutations after plating

Joshua and Ester Lederberg were also interested in the relation between mutations and the environment At that time (1950s), there were two new theories Directed mutation theory Selected conditions could promote the formation of specific mutations allowing the organism to survive This was consistent with Lamarck’s viewpoint Random mutation theory Environmental factors simply select for the survival of those individuals that happen to possess beneficial mutations This was consistent with Darwin’s viewpoint Random Mutations Can Give an Organism a Survival Advantage

Figure 16.7 Replica plating A few ton r colonies were observed at the same location on both plates!!! This indicates that mutations conferring ton r occurred randomly on the primary (nonselective plate) The presence of T1 in the secondary plates simply selected for previously occurring ton r mutants This supports the random mutation theory The Lederbergs developed a technique to distinguish between these two theories

Spontaneous mutations can arise by three types of chemical changes 1. Depurination 2. Deamination 3. Tautomeric shift Causes of Spontaneous Mutations The most common

Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine base is somewhat unstable It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar This is termed an apurinic site Fortunately, apurinic sites can be repaired However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication Causes of Spontaneous Mutations

Spontaneous depurination Figure 16.8 Three out of four (A, T and G) are the incorrect nucleotide There’s a 75% chance of a mutation

Deamination involves the removal of an amino group from the cytosine base The other bases are not readily deaminated Figure 16.9 DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication

Deamination of 5-methyl cytosine can also occur Thymine is a normal constituent of DNA This poses a problem for repair enzymes They cannot determine which of the two bases on the two DNA strands is the incorrect base For this reason, methylated cytosine bases tend to create hot spots for mutation Figure 16.9

A tautomeric shift involves a temporary change in base structure (Figure 16.10a) The common, stable form of thymine and guanine is the keto form At a low rate, T and G can interconvert to an enol form The common, stable form of adenine and cytosine is the amino form At a low rate, A and C can interconvert to an imino form These rare forms promote AC and GT base pairs Refer to Figure 16.10b For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication Refer to Figure 16.10c

Figure Rare Common

Figure 16.10

16-42 Figure Temporary tautomeric shift Shifted back to its normal fom

An enormous array of agents can act as mutagens to permanently alter the structure of DNA The public is concerned about mutagens for two main reasons: 1. Somatic mutagens are often involved in the development of human cancers 2. Germ-line mutations may have harmful effects in future generations Mutagenic agents are usually classified as chemical or physical mutagens Refer to Table 16.5 Types of Mutagens

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53

Chemical mutagens come into three main types 1. Base modifiers 2. Intercalating agents 3. Base analogues Mutagens Alter DNA Structure in Different Ways

Base modifiers covalently modify the structure of a nucleotide For example, nitrous acid, replaces amino groups with keto groups (–NH 2 to =O) This can change cytosine to uracil and adenine to hypoxanthine These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication Refer to Figure Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA Examples: Nitrogen mustards and ethyl methanesulfonate (EMS)

Mispairing of modified bases Figure These mispairings create mutations in the newly replicated strand

Intercalating agents contain flat planar structures that intercalate themselves into the double helix This distorts the helical structure When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions Examples: Acridine dyes Proflavin Ethidium bromide

Base analogues become incorporated into daughter strands during DNA replication For example, 5-bromouracil is a thymine analogue It can be incorporated into DNA instead of thymine Figure Normal pairing This tautomeric shift occurs at a relatively high rate Mispairing

Figure In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair

Physical mutagens come into two main types 1. Ionizing radiation 2. Nonionizing radiation Ionizing radiation Includes X rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free radicals Can cause Base deletions Single nicks in DNA strands Cross-linking Chromosomal breaks

Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply into biological molecules Causes the formation of cross-linked thymine dimers Thymine dimers may cause mutations when that DNA strand is replicated Figure 16.15

As we’ve seen, many mutations occur as the results of mistakes made by DNA polymerase during DNA replication Therefore, any chemical or hormone that promotes DNA replication is a mutagen Estrogen Relationship between length of menstruating years and breast/ovarian cancers Can also feminize animal populations Growth factors or mimics Can promote cancers in humans Tests often done in mice DNA Replication itself is mutagenic

The rate of cancer increases with age Diseases caused by new point mutations usually come from the father Testicular tissues undergoes many more rounds of DNA replication than ovarian tissue prior to meiosis Cancers develop when one mutation promotes DNA replication and cell division This promotes additional mutations Some of the new mutations further promote DNA replication and cell division (or mutate genes that down-regulated replication and cell division) This process continues to produce a malignant tumor DNA Replication itself is mutagenic

ONCE WE WERE TOGETHER