BrGGP2 Gene information BrGGP Gene information

Slides:

Advertisements

Similar presentations

RAPD Randomly Amplified Polymorphic DNA

Advertisements

RNA-Seq An alternative to microarray. Steps Grow cells or isolate tissue (brain, liver, muscle) Isolate total RNA Isolate mRNA from total RNA (poly.

Tutorial 7 Genome browser. Free, open source, on-line broswer for genomes Contains ~100 genomes, from nematodes to human. Many tools that can be used.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

AP Biology: Chapter 14 DNA Technologies

Recombinant DNA Technology……….. BTEC3301. DNA Libraries How do you identify the gene of interest and clone only the DNA sequence you are interested? Read.

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Agricultural Research Institute of the Hungarian Academy of Sciences Detecting inter- and intraspecific recombination events in plant RNA viruses with.

Fig. S1 Illustration of the fine-mapping evolution of cmr1 Arabidopsis mutant. F 2 mutant individuals were used for mapping. Molecular markers used in.

Analysis of the atp9 5‘ trailer A B At5S-5 Atatp9.Endo.Mega.A atp9 At5S-Mega.R (-239) (-84/- 83) (+180) 5S rRNA 5’ 3’ atp9 mRNA atp9 pre-mRNA atp9 5’ leader.

Overview JGIRASTManatee Length DescriptionThe Glug motifHalomucin [Precursor] Halomucin Table designed by Jay McNair.

Figure S1 Evolutionary relationships of RBG subclasses in Arabidopsis (a) and B. rapa (b). Optimal neighbor-joining trees with sum of branch lengths =

Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.

Assay I HLA-DQ Alpha (A1) Haplotype. Purpose To determine which one of several known alleles is present at the HLA DQ α locus on each of an individual’s.

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Searching for the Genes that Control Seed Development

C acaatataATGGAGCGTGAGACTTCGTCATCTTCAACTCCTCCGGAGGATCTTGTTACATCGATGATCGGAAAGTTCGTCGCTGTCATGTCTA b acaatataATGGAGCGTGAGACTTCGTCATCTTCAACTCCTCCGGAGGATCTTGTTACATCGATGATCGGAAAGTTCGTCGCTGTCTTGTCTA.

Microbial Genomes and techniques for studying them.

Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

Figure 1. miRNA processing and primer design

One method of rapidly analyzing and comparing DNA is gel electrophoresis. Gel electrophoresis separates macromolecules - nucleic acids or proteins - on.

PCR Polymerase Chain Reaction

Expression of the Genome

Section 3: Gene Technologies in Detail

* * * Fig. S1 XB21-Os12g36180 Os11g43950 At4g12770 At4g

Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A by Richard D. Bagnall, Naushin Waseem, Peter M.

Fig. S Fig. S2 Cre-mediated recombination in vivo. G2 mice displaying high levels of GFP were crossed.

Polymerase Chain Reaction

© 2013 Elsevier, Inc. All rights reserved.

by Nancy D. Borson, Martha Q. Lacy, and Peter J. Wettstein

DNA Sequencing The DNA from the genome is chopped into bits- whole chromosomes are too large to deal with, so the DNA is broken into manageably-sized overlapping.

Gene Editing Design Demo

The student is expected to: (6H) describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study.

Follicular lymphoma with a novel t(14;18) breakpoint involving the immunoglobulin heavy chain switch mu region indicates an origin from germinal center.

Fig. S3 Human genome consensus coding sequence

Accurate genotyping of hepatitis C virus through nucleotide sequencing and identification of new HCV subtypes in China population Y.-Q. Tong, B. Liu,

What is AT5G03500? --Background and Structure--

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Volume 14, Issue 5, Pages (March 2004)

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

DNA Diagnostics by Surface-Bound Melt-Curve Reactions

Volume 17, Issue 8, Pages (April 2007)

Accurate genotyping of hepatitis C virus through nucleotide sequencing and identification of new HCV subtypes in China population Y.-Q. Tong, B. Liu,

What is the “big picture” question?

Origin of Immunoglobulin Isotype Switching

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

A Presenilin-1 Truncating Mutation Is Present in Two Cases with Autopsy-Confirmed Early-Onset Alzheimer Disease Carolyn Tysoe, Joanne Whittaker, John.

RAD51 is essential for L. donovani.

Amplification Refractory Mutation System, a Highly Sensitive and Simple Polymerase Chain Reaction Assay, for the Detection of JAK2 V617F Mutation in Chronic.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Volume 17, Issue 1, Pages (January 2007)

Practical Contents DNA Extraction Gel Electrophoresis

Fig. 2. Validating the efficiency of smc3 MOs

Cloning and mapping of zebrafish nls/raldh2.

Identification of Skn-1n, a Splice Variant Induced by High Calcium Concentration and Specifically Expressed in Normal Human Keratinocytes Koji Nakajima,

Fig. 2 Overview of transcriptional mutagenesis in yeast.

Expression of multiple forms of MEL1 gene products.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

M L L L V L L V V L I L L I V R R Predicted transmembrane domain

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Volume 1, Issue 5, Pages (September 2008)

Mitochondrial DNA as a Cancer Biomarker

Detection of positive and negative KRBV genomic RNA strands as an indication of viral replication. Detection of positive and negative KRBV genomic RNA.

Presentation transcript:

BrGGP2 Gene information BrGGP Gene information Results Bra035554_BrGGP2 Base pair (bp) Primer design (bp) Amplification Tm Total length 1779 1774 (1-1774) No 57.5/58.4 Addition (N terminal) 540 (1-540) 378 (186-563) 58.4/58.4 Main sequence 1239 (541-1779) 1040 (736-1775) Yes 58.4/59.3 Linking sequence 21 (520-540) BrGGP Gene information Results Bra040607_BrGPP Base pair (bp) Primer design (bp) Amplification Tm Total length 1779 1745 (1-1745) No 59.3/61.3 Addition (C terminal) 996 (814-1779) 639 (319-957) 58.4/58.4 Main sequence 813 (1-813) 340 (1-340) Yes 59.3/58.4 Linking sequence 33 (814-846) Gene Forward primer Reverse primer Size BrGGP2_full gene ATGGTGCAATTAATGAAGCTACT TAGATACAGCCTCTTCTTTCAC 1774 BrGGP2_Fusion AAAGGTCGACAACGGTCAAG ACCCTTTTGATCGTGGACTG 378 BrGGP2_main GAGTGGGAAGATCGGTTTCA TTAGATACAGCCTCTTCTTTCAC 1040 BrGPP_full gene ATGGCTGAAAATGGTTCACTAGA TCCTCGTCATCCTCATCATCG 1745 BrGPP_Fusion TGTGTTTCCATTGGCATTACCA AGGCTGCTCTGATTCGTTGT 639 BrGPP_main1 TGGTAATGCCAATGGAAACACA 340 BrGPP_main2 TCCATTTGTAAGCCGCAACG 813 Fig. S2 Validation of nucleotide addition in Bra03554 (BrGGP2) and Bra040607 (BrGPP) by RT-PCR. cDNA Samples: Brassica rapa – Root (R), Stem (S), and Leaf (L). Full genes (BrGGP2 and BrGPP) were not amplified but main sequences (BrGGP2 and BrGPP) were amplified well.

AT5G21100 52.5% similarity to AT4G39830 63.4% similarity to AT4G39830 AT5G21105 79.7% similarity to AT4G39830; 74.5% similarity to AT5G21100 AO class AT4G35000 62.6% similarity to AT3G9640 AT4G35970 60.3% similarity to AT1G07890 and AT4G32320 AT1G77490 71.6% similarity to AT3G09640 AT4G08390 68.8% similarity to AT3G09640 APX class AT1G19550 96.4% similarity to AT1G19570 DHAR class AT3G52880 67.7% similarity to AT3G09940; 64.9% similarity to AT1G63940 AT5G03630 90% similarity to AT3G52880 79% similarity to AT3G09940 AT1G63940 51.6% similarity to AT3G09940 MDAR class Fig. S3 Recombination events among the ascorbic acid biosynthesis (ABGs) and recycling (ARGs) genes in Arabidopsis. The ORF of AtABGs and AtARGs genes were analyzed for recombination signatures using all available recombination detection methods (RDP, BOOtscan, MaxChi, Chimaera, SiScan, 3Seq and LARD) in RDP v4.35. Genes with no recombinations are not shown

47.3% similarity to Bra027452_BrPGI3 Fig. S4 Recombination events among the ascorbic acid biosynthesis (ABGs) and recycling (ARGs) genes in Brassica rapa. The ORF of BrABGs and BrARGs genes were analyzed for recombination signatures using all available recombination detection methods (RDP, BOOtscan, MaxChi, Chimaera, SiScan, 3Seq and LARD) in RDP v4.35. Genes with no recombinations are not shown Bra019214_BrPGI2 47.3% similarity to Bra027452_BrPGI3 Bra019082_GGP3 Bra010424_GGP4 (91.9% similarity) Bra021239_AO1 56.1% similarity to Bra002356_AO4 Bra020145_AO2 79.2% similarity to Bra021239_AO1 74.2% similarity to Bra040902_AO6 75.2% similarity to Bra002356_AO4 56.2% similarity to Bra021239_AO1 Bra002357_AO3 Bra040902_AO6 90.6% similarity to Bra002357_AO3 85.1% similarity to Bra002355_AO5 70.2% similarity to Bra002356_AO4 61.2% similarity to Bra021239_AO1 74.4% similarity to Bra021239_AO1 Bra013053_APX2 61.3% similarity to Bra034076_APX1 Bra017686_APX4 65.8% similarity to Bra034076_APX1 Bra015668_TAPX 58% similarity to Bra023954_APX3; 48.7% similarity to Bra013053_APX2 Bra037859_SAPX 76.2% similarity to Bra015668_TAPXUnknown 59.3% similarity to Bra023954_APX3; 54.8.7% similarity to Bra013053_APX2 Bra025749_DHAR3 89.4% similarity to Bra008188_DHAR2 87.5% similarity to Bra016503_DHAR4 78.4% similarity to Bra008188_DHAR2 Bra016503_DHAR4 78.9% similarity to Bra008188_DHAR2 Bra033028_MDAR1 56.9% similarity to Bra006954_MDAR6 Bra001293_MDAR3 Bra025303_MDAR4 58.6% similarity to Bra006954_MDAR6 Bra027670_MDAR5 60% similarity to Bra001293_MDAR3 67.8% similarity to Bra006954_MDAR6

AT1G67070_PMI AT1G07890_APX AT1G19550_DHAR* AT1G77490_tAPX AT1G75270_DHAR AT1G19570_DHAR* AT1G63940_MDAR A01 AT2G45790_PMM AT2G39770_GMP A02 AT3G02570_PMI AT3G55590_GMP AT3G02870_GPP AT3G47930_GLDH AT3G09640_APX AT3G52880_MDAR AT3G09940_MDAR AT3G27820_MDAR AT3G54660_GR AT3G24170_GR A03 AT4G24620_PGI AT4G30570_GMP AT4G26850_GGP AT4G33670_GalDH AT4G39830_AO AT4G35970_APX AT4G32320_APX AT4G08390_sAPX AT4G35000_APX A04 AT5G42740_PGI AT5G28840_GME AT5G21100_AO* AT5G55120_GGP AT5G21105_AO* AT5G03630_MDAR AT5G16710_DHAR A05 Fig. S5 Physical mapping of ascorbic acid-related genes onto the Arabidopsis genome. Chromosome numbers are indicated at the top of each chromosome. The image was generated automatically by submitting the IDs of AtRBGs via the chromosome map tool to the TAIR database (https://www.arabidopsis.org/jsp/ChromosomeMap/tool.jsp). Chromosome sizes are indicated by their relative lengths.