Tapestry Workshop: Mentoring for Connections to Computing Activities Karen C. Davis Professor, Electrical & Computer Engineering

Difference EngineJacquard Loom

Online Unplugged Resources mathmaniaCS.org CSunplugged.org ** birthday prediction **

[boardgamegeek.com] Graph Traversal

[boardgamegeek.com] Digital Logic Movement Programming Surface Tiling

hit the books College Success Roborally go to class design computing systems make the Dean’s List graduate!

Software Specification [boardgamegeek.com] Grammar Rules Pattern Recognition Project Management Sorting

Pattern Recognition Warm-up colorshapenumbershading o same o different o same o different o same o different o same o different Is this row a set? √ √ xx

Pattern Recognition Warm-up colorshapenumbershading o same o different o same o different o same o different o same o different √√ Is this row a set? √ √

Pattern Recognition Warm-up colorshapenumbershading o same o different o same o different o same o different o same o different √ √ Is this column a set? √ √ let’s try it!

Internet Message Routing Embedded Computers Land Mobile Radio Communications Bioinformatics Computer Chip Design Scheduling with Graph Coloring Medical Imaging Scheduling with Graph Coloring

Virtual Fashion Design Pipe Layout Design Bear-a-Trooper Pattern Recognition Artificial Intelligence Binary Numbers

Vision and Precision Multitasking Pixels and Pellets Wii Debate

Computer Science Investigations: CSI Cincinnati Scheduling

Problem Exploration

Graph A C B E F D node edge 3 edges are adjacent to D

Graphs can be represented in a computer program can be used to solve complex problems Example: find the cheapest way for a traveler to visit every city Atlanta Cincinnati Boston Eugene Fairbanks Dallas $900 $700 $800 $200 $100 $300 $400

Exhaustive vs. Approximate Searching Searching for all possible solutions takes a long time, even for a computer, when there are lots of nodes We use algorithms that search for a good enough solution but don’t try all possible solutions n(n 2 – n)/ ,950 1,000499,500 10,00049,999, ,0004,999,950,000

Using an Approximate Graph Algorithm for Scheduling A C B E F D event to be scheduled conflict between events

Solution Technique: Setup

Solution Technique: Algorithm

Assigning Frequencies in Cellular Networks

1.count the adjacent edges 2.color the one with the highest edge count 3.color any others (not adjacent) with the same color 4.pick a new color and repeat steps 2-4 until all nodes are colored Using the Algorithm to Assign Cell Tower Frequencies let’s try it!

Automated Graph Coloring graph coloring animation

Computer Science Investigations: CSI Cincinnati Artificial Intelligence

Goal of Artificial Intelligence Can intelligence be modeled by a machine? A scientific approach is that the behavior of an intelligent organism can be studied and engineered

CAPTCHA reCAPTCHA: digitizing books using OCR words it can’t recognize are sent out as CAPTCHA words users help to disambiguate the words and demonstrate that they are human Completely Automated Public Turing test to tell Computers and Humans Apart reverse Turing test CAPTCHA trademarked by Carnegie Mellon University

analysis of DNA to find genes analysis of RNA to predict structure designing new drug molecules

Recognizing Defects normal DNA atggtgcacctgactcctgaggagaagtctgc cgttactgccctgtggggcaaggtgaacgtg gatgaagttggtggtgaggccctgggcaggt tgctggtggtctacccttggacccagaggttct ttgagtcctttggggatctgtccactcctgatg ctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatgg cc … defective DNA atggtgcacctgactcctgtggagaagtctgc cgttactgccctgtggggcaaggtgaacgtgg atgaagttggtggtgaggccctgggcaggttg ctggtggtctacccttggacccagaggttcttt gagtcctttggggatctgtccactcctgatgct gttagggcaaccctaaggtgaaggctcatgg caagaaagtgctcggtgcctttagtgatggcc … glutamic acidvaline

Computers are good at recognizing patterns … that involve huge quantities of data that are complex and non-intuitive

Decision Trees

20Q Let’s get hands on with some real AI –play 20Q with a group agree on one object agree on group answer to 20Q’s questions –make observations on the worksheet use buttons to provide answers questions appear here play online:

Computer Science Investigations: CSI Cincinnati Wii Debate

1. start here facing downward 2. figure out a sequence of moves to finish here bumping into a wall keeps you in the same spot falling into a pit or off the board ends your turn