미래의 계 산 화공생명공학과 01 김선호

Outline Quantum Computing DNA Computing Single Electron Transistor

Quantum Computing

Qubit Qubit Qubit a bit represented by a quantum system mathematical object with certain properties same as the classical bit is an object with two states 0 and 1 By convention: A qubit state 0 is the spin up state A qubit state 1 is the spin down state 0 1

A qubit is governed by the laws of quantum physics superposition While a quantum system can be in one of a discrete set of states, it call also be in a blend of states called a superposition That is a qubit can be in: c 0 + c 1 c 0 +c 1 = 1 Qubit (cont.)

Quantum Computing Hypothetical machine that uses quantum mechanics to perform computations. Conventional computer runs on binary system of 0,s and 1,s Quantum computer simultaneously represents 0 and 1 on one ‘qubit’

Characteristics Quantum computing generates a massive parallel computation in one piece of quantum hardware This means that quantum computer can in one computational step perform the same mathematical operation on 2 L different input numbers encoded in coherent super-positions of L qubits Classical computers would repeat the same computation 2 L times

Comparison 0 or 1 0 or 1 or 0 1 Classical bit Quantum bit Classical register Quantum register

Bits vs. Qubits Bit unit of classical information n bits can carry information on only 1 number at a time Qubit unit of quantum information n qubits carry information on 2 n numbers at the same time

Summary Quantum Computer very fast does not slow down too much as number of bits increase but …….. No working models exist yet! Classical Computer Require exponentially more time Can require more registers in parallel slow down dramatically as number of bits increase

Potential of Quantum Computing Quantum Communication Quantum Cryptography Artificial Intelligence

Problems w/ Quantum Computing When qubits are implemented as spinning electrons the problem facing quantum computing is: Isolating individual qubits Manipulating individual qubits Technology for these actions is being developed but is fairly new and theoretical If we change the definition of a qubit we can take advantage of a well established technology – Nuclear Magnetic Resonance (NMR)

Conclusion QCs may one day replace silicon chips, but required technology is beyond reach Most research in QC is theoretical, QC is in early stages of development

DNA Computing

The First DNA Computing Approach In 1994 Leonard Adleman demonstrated the potential of using interactions between DNA molecules to carry out “massive parallelism” in a test tube to solve hard combinatorial problems(Hamiltonian Path Problem)

ATGCTCGAAGCT DNA Computing

HPP... ATG ACG TGC CGA TAA GCA CGT Solution PCR (Polymerase Chain Reaction) ATGTGCTAACGAACG ACGCGAGCATAAATGTGCCGT TAAACG CGACGT TAAACGGCAACG... CGACGTAGCCGT... ACGCGAGCATAAATGTGCCGT ACGCGTAGCCGT ACGCGT... ACGGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCCGT ACGCGAGCATAAATGTGCCGT... ACGCGAGCATAAATGTGCCGT Decoding Ligation Encoding Gel Electrophoresis Affinity Column ACGCGAGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCACGCGT ACGCGAGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCACGCGT Node 0 : ACGNode 3 : TAA Node 1 : CGANode 4 : ATG Node 2 : GCANode 5 : TGC Node 6 : CGT

Why Try DNA Computing?  molecules / mole Immense, Brute Force Search of All Possibilities Desktop : 10 6 operations / second Supercomputer : operations / second 1  mol of DNA : J for 2  operations Storage Capacity: 1 bit per cubic nanometer

DNA Computers vs. Conventional Computers DNA-based computersMicrochip-based computers slow at individual operationsfast at individual operations can do billions of operations simultaneously can do substantially fewer operations simultaneously can provide huge memory in small space smaller memory setting up a problem may involve considerable preparations setting up only requires keyboard input DNA is sensitive to chemical deterioration electronic data are vulnerable but can be backed up easily

Applications Massively parallel problem solving Combinatorial optimization Molecular nano-memory with fast associative search AI problem solving Medical diagnosis, drug discovery Cryptography Biocomputer Further impact in biology and medicine: Wet biological data bases Processing of DNA labeled with digital data Sequence comparison Fingerprinting

Problems of DNA Computing Takes excess amount of time Hybridization/ligation operation over 4 hours In Adleman’s experiments : 7 days! Imperfect Operation Hybridization Mismatches Mismatched Hybridization Hairpin Hybridization Shifted Hybridization Extraction Errors Volume and Mass to solve a problem False Negatives False Positives

a) Self-replication: Two for one Based on DNA self-replication b) Self-repair: Based on regeneration c) DNA computer mutation/evolution or biohazard Learning. May be malignant d) New meaning of a computer virus ? Interesting Possibilities

Evolvable Biomolecular Hardware Sequence programmable and evolvable molecular systems have been constructed as cell-free chemical systems using biomolecules such as DNA and proteins.

Molecular Storage for Massively Parallel Information Retrieval Trillions of DNA NameTel.Address James Washington DC David La Jolla, CA. Paul Honolulu, HI Julia Palo Alto CA … Phone book

Molecular Computer on a Chip DNA computing algorithm MEMS (Microfluidics) + Real DNA computer [Zhang, 2001]

Sample handling Separation Detection Data analysis on a single chip Lab on a Chip

Conclusion DNA computing uses DNA molecules as storage material and their liquid-phase biochemical reactions for processing. DNA computing technology has many interesting properties, including Massively parallel, solution-based, biochemical Miniaturized, nano-scale, biocompatible High energy efficiency High memory storage density DNA computing is in a very early stage of development, but seems very promising, especially for solving the class of problems which are inherently difficult for solid-state silicon computers.

Single Electron Transistor

Introduction Why we need Single Electron Transistor(SET)s How a Single Electron Transistor(SET) works Current turned on/off using one electron Necessary electric power greatly reduced

Single Electron Transistor - Island potential is capacitively controlled by the gate. - Coulomb blockade is overcome by changing the gate voltage Advantage - ultra low power operation - fast e source drain gate Island I V Vg =1V Vg =-1V Single Electron Transistor

Principle of the SET

Challenges Nano-scale materials Changes in material properties Development of Nanotechnology Semiconductor nanoparticles Nanopattering technology

Example: SET at 100K S.Y. Chou et al, Appl. Phys. Lett 67, 938 (1995) Si dot with 20nm diameter : energy spacing = 40meV Current oscillation due to the interference between different modes of quantum waves in a cavity

Example: SET operating at room temperature K. Matsumoto et al, Appl. Phys. Lett. 68, 34 (1996) Unclear coulomb staircase due to the symmetric size of the tunnel juncton Coulomb staircase with periods of 150mV

Olympic athlete is on the run : THE SPRINTER Dave Wilson has been stripped of his Olympic gold medals, it was confirmed last night. This follows reports that he has been using nanorobots to enhance his performance. Wilson was the first man to break the 'unbreakable' nine- second 100m record. 'Sports cheats have had to come up with more ingenious ways of cheating since our drug tests have become virtually infallible,' commented a test spokesman, 'but we were pretty surprised at this.' It is thought that Wilson had hundreds of nanorobots injected into his body. The microscopic devices, each one smaller than a grain of sand, were equipped with a tiny motor and flaps designed to boost the sprinter's blood flow. This allowed more oxygen to be delivered to his muscles than is naturally possible. It is also believed that the devices were able to store excess oxygen when the athlete was not running. The nanorobots' engines then pumped out these reserves as required. 'It's the equivalent of having an extra lung,' said the official. 'I must admit I was taken in by Wilson's cover story of hard training and meditation, but I did wonder why his tough workouts before big races didn't tire him. 'We think he was using these workouts to increase his blood pressure so that the nanorobots would kick in when the race started. 'The use of nanorobots explains why a guy who was rarely off the blocks first could make up so much distance in the last two-thirds of a race.' The Olympic Committee made the shock discovery during a random blood test. The disgraced sprinter is in hiding as investigators search for the creator of the nanorobots. SH (Humurous fiction)

QC lecture.ppt Computing.ppt / References

DNAC %C7%D1%B3%B2%B4%EB_.ppt

References SET