Sesha Kiran Kollipara, Vikas Solanki and Bikash Mandal Cloning and Expression of Coat Protein gene of Cucumber Green Mottle Mosaic Virus in Escherichia coli Sesha Kiran Kollipara, Vikas Solanki and Bikash Mandal Advanced Centre for Plant Virology, Division of Plant Pathology, IARI, PUSA Campus, New Delhi-12 Corresponding E-mail: leafcurl@rediffmail.com Introduction Cucumber green mottle mosaic virus (CGMMV), a member of the genus Tobamovirus in the family Virgaviridae is a widespread virus infecting cucurbitaceous crops. Here, we report the cloning, expression and purification of coat protein in Escherichia coli BL-21 (DE3) Codon Plus RIPL strain .Expressed coat protein can be used for production of anti body which can be used for the immunodiagnostic of CGMMV. Materials and Methods: Viral RNA was extracted as total RNA from CGMMV infected leaf of bottle gourd plants grown in containment facility at IARI, New Delhi. cDNA was synthesised by Verso Enzyme Mix (Thermoscientific) using total RNA extract as template and specific primer (BM557R) targeting the 3’ end of the viral coat protein gene. PCR amplification was carried out using first strand cDNA synthesis product as template and specific primers (BM556F CGGGATCCATGGCTTACAATCCGATC and BM557R CGGGATCCATGGCTTACAATCCGATC) were targeted at 5’ and 3’ ends of the coat protein gene of CGMMV in a standard PCR reaction. Advantage Polymerase Mix was used for amplification of Coat protein gene. PCR product of the appropriate size (486 bp) was cloned in pGEM- T easy vector (Promega).Core CP gene clone was restricted with BamH1 and EcoR1 and recloned in pET-29a(+) expression vector and transformed in E.coli BL-21 Codon Plus RIPL strain Overnight grown culture containing the construct of core CP of CGMMV was grown in 5 ml of Luria broth at 37 0C and induced for expression by adding IPTG (1.0 mM) for overnight with vigorous shaking at 250 rpm. Bacterial cells were collected by centrifuging at 10,000X g at 40C for 10 minutes, dissolved in 1.0 ml of 1X PBS (pH 7.4) and samples were sonicated till they became clear. Sonicated samples were centrifuged at 12,500 rpm for 10 min at 40 C. Pellet was collected and dissolved in 1X PBS. Resuspended pellet was run on 12 % SDS-PAGE. Gels were stained for proteins with Coomassie Brilliant Blue in 50 % Methanol and 10 % Glacial Acetic Acid. Insoluble sonicated fraction containing the expressed protein obtained from one liter of overnight induced culture was dissolved in 1X Sodium Dodecyl Sulphate (SDS) sample buffer and electrophoresed in 12% SDS –PAGE and the gel was stained with Coomassie Brilliant Blue. Excised and completely destained protein band was crushed in a pestle and mortar using 5 % SDS and supernatant containing the protein was collected discarding the traces of SDS by precipitation on ice. Purified protein solution was dialysed against (90%) sucrose solution for 6 hrs at 40C. Results Coat protein was amplified from CGMMV infected leaf tissues at 486 bp DNA fragment and the sequence analysis revealed that the clone contained the same which is full length coat protein gene of CGMMV. Sequence analysis indicated that the CGMMV CP gene was in frame with the S-tag at 5’ end and His tag at 3’ end. PCR induced mutation was not observed as Advantage Polymerase mix was used for amplification of coat protein gene. Optimisation of coat protein expression: Highest expression of Coat protein was obtained when IPTG was used at 1.0 mM concentration to induce coat protein gene of E.coli grown at 370 C for overnight. Purification of coat protein of CGMMV Gel extraction method of protein purification showed no precipitation during dialysis and no background of E.coli protein as judged by SDS-PAGE. Yield of the gel extracted protein was 3.0 mg/ml from 500 ml of E.coli grown when 5 % SDS was used for purification. When the expressed protein content was analysed with western blotting using Anti CGMMV antiserum as detection antibody, a protein band of 23.5 KDa was detected in CGMMV coat protein alone but not in the negative control clone. Based on the Western blot result, the molecular weight of the expressed coat protein was therefore estimated to be 17.3 KDa equivalent to its predicted molecular weight from nucleotide sequence while the other 6.27 KDa was contributed by the fusion partner which is of pET-29 a(+). Western blot analysis also displayed positive binding activity to anti-CGMMV antiserum, showing the bacterial expressed CGMMV coat protein still maintained the native epitopes in the virus. CGMMV symptoms on Bottle Gourd CGMMV particles Optimization of coat protein Expression Conclusion: Successful expression and purification of coat protein of CGMMV from E. coli can be used for production of polyclonal antibody required for diagnosis of CGMMV Acknowledgement: I thank administration of Dr. Y.S.R.Horticultural University, Andhra Pradesh for deputing me to Indian Agricultural Research Institute, Delhi for pursuing Ph.D Excised Protein Western Blot Analysis displayed positive binding with Anti CGMMV Antiserum Uninduced Vector alone M 1 2 3 4 Amplified CP Amplification of CP from cDNA M 0.5 1.0 1.5 2.0 Construct in p Et- 29a (+) M 1 2 3 4 5 -Ve M 1 2 3 4 M -Ve 1 2 3 4 5 6 7 Uninduced induced IPTG concentration (mM)