DETECTION OF THE VIRUSES BY USING RT-PCR

Slides:

Advertisements

Similar presentations

Table 1. Degenerate potyvirus primers used to detect potyviruses in Iraqi plants by RT-PCR. NT: not tested, NS: non specific bands, +: positive, -: negative,

Advertisements

RAPD Randomly Amplified Polymorphic DNA

Virus discovery-454 sequencing

General guidelines for primer design nucleotides G/C content: 40-60% Avoid complementary sequences of primers (especially at the 3’ end) Avoid mismatches.

DNA Technology. Biotechnology The use or alteration of cells or biological molecules for specific applications Transgenics Transgenic “changed genes”

Gene Regulation: What it is, and how to detect it By Jordan, Jennifer, and Brian.

Chapter 20 Reading Quiz Genes from two different sources that are combined result in ____. Where are “sticky ends” found? What structures, naturally found.

INTRO TO MOLECULAR GENETICS Restriction enzymes Mapping Cloning PCR Sequencing Genetic engineering.

Fig 11-1 Chapter 11: recombinant DNA and related techniques.

Genetic engineering to produce an organism which will make a ‘foreign’ protein:  Obtain ‘foreign’ gene  Amplify using PCR  Insert gene into a vector.

DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Recombinant DNA Technology……….. BTEC3301. DNA Libraries How do you identify the gene of interest and clone only the DNA sequence you are interested? Read.

Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.

Bioactivity of indigenous medicinal plants against the cotton whitefly, Bemisia tabaci by E. Abou-Fakhr Hammad, A. Zeaiter, N. Saliba, and S. Talhouk J.

The case:  2005: No production Continued sampling  2006: Detected plants expressing transgene - demonstrated pollen transfer and seed dispersal (Reichman.

Chapter 20 Reading Quiz 1. Genes from two different sources that are combined result in ____. 2. Where are “sticky ends” found? 3. What structures,

Whiteflies Biology and control

Effects of a begomovirus on tritrophic interaction of tomato, whitefly Bemisia tabaci and its parasitoid Eretmocerus hayati Yin-Quan Liu Institute of Insect.

Biotechnology and Recombinant DNA. Biotechnology The use of microorganisms, cells, or cell components to make a product – Foods – Vaccines – Antibiotics.

IsolateName of each RNA genome sequenceHost plantRegionRNA genomeAccession # TSWV-1TSWV Tomato NJ-JN TSWV_1_LTomatoNa-Ju (NJ) city, Jeon-Nam (JN) provinceLHM

PCR Polymerase Chain Reaction PCR Polymerase Chain Reaction Marie Černá, Markéta Čimburová, Marianna Romžová.

Fig. S1 Beclin1, ATG3 and LC3B mRNA -real-time quantitative PCR HCT-116 HT-29.

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

Figure 1. RT–PCR identification of an abnormal transcript of the PTPN6 gene in normal and leukemic bone marrow cells and cell line. (a) Diagrammatic representation.

Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.

A B D C E 5 kb 2 kb Copies per 1,000 GAPDH copies. UL US TRL

Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A by Richard D. Bagnall, Naushin Waseem, Peter M.

Fusion of a Novel Gene, BTL, to ETV6 in Acute Myeloid Leukemias With a t(4;12)(q11-q12;p13)‏ by Jan Cools, Chrystèle Bilhou-Nabera, Iwona Wlodarska, Christine.

Characterization of the Human Platelet/Endothelial Cell Adhesion Molecule-1 Promoter: Identification of a GATA-2 Binding Element Required for Optimal Transcriptional.

by Nancy D. Borson, Martha Q. Lacy, and Peter J. Wettstein

Strategy for F1 mutation carrier screening and identification of their mutations. Strategy for F1 mutation carrier screening and identification of their.

Access to Sequence Data and Related Information

In Vivo Tropism of Hepatitis C Virus Genomic Sequences in Hematopoietic Cells: Influence of Viral Load, Viral Genotype, and Cell Phenotype by Hervé Lerat,

DNA TECHNOLOGY.

by Takashi Kasukabe, Junko Okabe-Kado, and Yoshio Honma

Transduction of Primitive Human Marrow and Cord Blood-Derived Hematopoietic Progenitor Cells With Adeno-Associated Virus Vectors by Saswati Chatterjee,

Type 17 immunity is increased in STAT1−/− mice.

Mutations in the Liver Glycogen Phosphorylase Gene (PYGL) Underlying Glycogenosis Type VI (Hers Disease) Barbara Burwinkel, Henk D. Bakker, Eliezer Herschkovitz,

Overview of the proposed standard operating procedure (SOP) for rapid next-generation sequencing library preparation and inactivation of ssRNA+ viruses.

Expression and regulation of MD-2s.

Rose-Anne Romano, Barbara Birkaya, Satrajit Sinha

Complete Cure of Persistent Virus Infections by Antiviral siRNAs

Exon Circularization Requires Canonical Splice Signals

Volume 2, Issue 5, Pages (September 2009)

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Trans-Splicing to Spliceosomal U2 snRNA Suggests Disruption of Branch Site-U2 Pairing during Pre-mRNA Splicing Duncan J. Smith, Charles C. Query, Maria.

Edwards Allen, Zhixin Xie, Adam M. Gustafson, James C. Carrington Cell

NGS on SOP-generated HRV-16-specific sequence from pure and mixed samples is slightly less sensitive than quantitative real-time RT-PCR (qrRT-PCR). NGS.

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

Volume 42, Issue 6, Pages (June 2005)

Interspecies transmission of SsPV1/WF-1 from S. sclerotiorum to S

RAD51 is essential for L. donovani.

Nucleotide sequence alignment of porA gene sequences from the examined English Neisseria gonorrhoeae porA mutants, compared to the porA sequences of previously.

Schematic representation of a transcriptomic evaluation approach.

Fig. 2. Validating the efficiency of smc3 MOs

CREB1 promotes the induction of endogenous ERα target genes.

Multiplexed Mutagenesis Using the Csy4 System in Tomato Protoplasts.

The endogenous IGRP gene is selectively expressed in βTC-3 cells and not in Y1 cells. βTC-3 RNA (50 μg) and Y1 RNA (50 μg) were annealed to labeled oligonucleotide.

Sequence variation of 16S rRNA gene primer-binding sites.

Identification of a Commonly Used CDR3 Region of Infiltrating T Cells Expressing Vβ13 and Vβ15 Derived From Psoriasis Patients Ha Young Hwang, Young.

Multiplex PCR assay to detect common resistance determinants in B

Recovery template. Recovery template. The recovery template (internal control) has the same sequence as the PCR product except the probe region has been.

Construction of sgRNA expression cassette.

by Honglin Chen, Paul Smith, Richard F. Ambinder, and S. Diane Hayward

Targeting DCLK1 by miRNA-137.

Detection of PSA-mRNA by single (first panel, 710 bp) and nested (second panel, 455 bp) RT-PCR. Detection of PSA-mRNA by single (first panel, 710 bp) and.

Figure Genetic characterization of the novel GYG1 gene mutation (A) GYG1_cDNA sequence and position of primers used. Genetic characterization of the novel.

RT-PCR Gel Blot Analyses of Cucurbita PP1 and PP2 mRNAs from Intergeneric Grafts of Cucumis sativus Scions on Cucurbita maxima or Cucurbita ficifolia Stocks.RT-PCR.

Multiplex PCR for the simultaneous detection of cassava mosaic and brown streak viruses in cassava plants 1Abarshi M. M., 1Mohammed I. U., 2Kumar P. L.

Detection of positive and negative KRBV genomic RNA strands as an indication of viral replication. Detection of positive and negative KRBV genomic RNA.

Presentation transcript:

DETECTION OF THE VIRUSES BY USING RT-PCR Oligonucleotide primers that can amplify both ToCV and TICV genomes were designed based on the nucleotide sequences of the CP and mCP genes (GenBank Accession numbers NC_007341 and FJ542306, respectively); 360 417 Primer ToCV-CF [5’GTGTCAGGCCATTGTAAACCAAG3’] corresponding to nucleotides 4682 -4705, and Primer ToCV-CR [5’CACAAAGCGTTTCTTTTCATAAGCAGG3’] complementary to nucleotide 5014-5041. Primer TICV-CF [5’AATCGGTAGTGACACGAGTAGCATC3’] corresponding to nucleotides 5629-5654, Primer TICV-CR [5’CTTCAAACATCCTCCATCTGCC3’] complementary to nucleotides 6023-6045.

DETECTION OF THE VIRUSES BY USING RT-PCR Total RNA was extracted from tomato samples infected either by ToCV or TICV, or mixinfected by ToCV and TICV. Healthy tomato plants were used as negative controls. M To TI To+TI H M To TI To+TI H M To TI To+TI H Primer ToCV-CF+CR Primer TICV-CF+CR Primer Mix ToCV-CF+CR and TICV-CF+CR

DETECTION OF THE VIRUSES BY USING RT-PCR Magelang [Central Java] Cipanas [West Java] Sembalun [Lombok] Garut [West Java] Bedugul [Bali] M H TICV ToCV Primer Mix ToCV-CF+CR and TICV-CF+CR

DETECTION OF THE VIRUSES BY USING RT-PCR Samples collection site Number of samples tested Number of samples infected by ToCV Number of samples infected by TICV Number of samples infected by ToCV +TICV Baturiti [Tabanan] 19 13 3 Ketep [Magelang] 21 12 8 1 Cikajang [Garut] 9 2 Pacet [Cianjur] 11 6

STUDY ON INSECT TRANSMISSION OF THE VIRUSES Transmission tests for different species of whiteflies were made by the leaf cage method described previously [Cohen et al., 1983]. Tests were performed for determination of the transmission by different insect species [Trialeurodes vaporariorum or Bemisia tabaci] and vector efficiency.