European hazelnut (Corylus avellana) Golnaz Komaei Hazelnut Breeding

I originally come from Iran. Bachelor: Agronomy and Plant Breeding at University of Tehran(2009) Master : Genetics and Plant Breeding( Wheat breeding) at University of Tehran(2012) Worked as a graduate student on wheat breeding program at University of Nebraska-Lincoln(2013) PhD student, working on hazelnut breeding program with Shawn Mehlenbacher at Oregon State University(2014)

Areas of commercial production located near large bodies of water at mid-latitudes in the Northern Hemisphere with mild, moderate temperatures in winter and summer, and high humidity during mid-winter bloom (along the Black Sea in Turkey, the Mediterranean in Italy and Spain, the Atlantic coast in France, the Willamette Valley in Oregon) Turkey with 70% of the world’s production is the largest hazelnut producer followed by Italy, United States, Azerbaijan and Georgia. In the United States, 99% of the hazelnuts are produced primarily in the Willamette Valley of Oregon.

Highly heterozygous diploid (2n= 2x= 22) Small genome (~400 Mb) Highly heterozygous diploid (2n= 2x= 22) (two different alleles of a gene) Monoecious (having both the male and female reproductive organs in the same tree) Clonally propagated tree

Two characteristics of hazelnuts enforce the cross pollinating: Cross pollinated crop (pollen should come from another tree) Two characteristics of hazelnuts enforce the cross pollinating: Incompatibility Dichogamy

Steps for controlling crosses

Incompatibility Controlled by S-locus with multiple alleles 33 alleles controlling self-incompatibility Each allele is defined by a number

Dichogamy The male and female reproductive elements mature at different times, thus preventing self-pollination.

Research plan Study the inheritance of eastern filbert blight resistance from new sources, with an emphasis on Moscow selections and Holmskij OSU 1187.101. Generate a high-density map for hazelnut using genotyping-by-sequencing. Integrate the high-density map, physical map of BACs and the genome sequence of 'Jefferson' hazelnut.

Eastern filbert blight (EFB) What is the problem? Eastern filbert blight (EFB) Discovered in the Willamette Valley in 1986. The fungus has a 2-year life cycle, Ascospores are released in winter and spread by rain and wind. 12-16 months after infection, cankers become visible.

Host genetic resistance The costs and labor involved with controlling the disease with cultural practices and fungicides are intensive. Our solution!! Host genetic resistance

Resistance to EFB was first discovered in ‘Gasaway’, which is controlled by a dominant allele at a single locus. So, Are we done?!

Resistance based on the single dominant gene from‘Gasaway’ may not be durable. New races of the fungus that can overcome this R-gene may be introduced or arise from mutation or recombination. How to solve it?? "Pyramiding" of different R genes

To find out that if the tree has a resistant gene or not we need both phenotypic data and genotypic data. Inoculation with spores of fungi Using genetic marker Molecular markers are genetic loci that can be easily tracked and quantified in a population and may be associated with a particular gene or trait of interest

Steps for collecting phenotypic data

Simple Sequence Repeats •SSRs are repeating sequence of 2-6 bp of DNA segments. •Mutation, replication slippage, unequal crossover evolves microsatellites. •Wide application in plant breeding. Polymorphism is the number of (AAGC) repeats. Individual 1: TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCTAGTTGTAAAGG Individual 2: TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCAAGCTAGTTGTAAAGG Individual 3: TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCAAGCAAGCAAGCTAGTTGTAAAG

Genetic Linkage Maps •Representation of the relative position of genes or markers along a chromosome •Chromosome = “linkage group” •Map positions inferred from recombination frequencies between genes or markers.

Uses of Genetic Linkage Maps •Gene localization •Starting point for map-based cloning •Marker assisted selection •Genome assembly improvement

Sources of resistance: •EFB resistance from 'Gasaway' was assigned to linkage group 6 (LG6) •C. heterophylla ‘Ogyoo’, ‘Grand Traverse’, Uebov (LG6) •OSU 408.040, ‘Culpla’, ‘Crvenje, OSU 495.072 (LG6) •'Ratoli‘, C.americana ‘Rush’, Yoder#5 (LG 7) •Georgian OSU 759.010 (LG 2) (Mehlenbacher et al.,2006, Lunde et al.,2000, Sathuvalli et al.,2011, Sathuvalli et al.,2011, Sathuvalli et al.,2012, Bhattarai 2015)

Genetic linkage maps have been constructed in clonal species: a.Potatoes (Tanksley et al. 1992; van Os et al. 2006) b.Cassavas (Fregene et al. 1997; Kunkeaw et al. 2010) c.Sweet potatoes (Li et al. 2010) d.Sugarcanes (Liu et al. 2010) e.Populus (Zhang et al. 2000) f.Pears (Yamamoto et al. 2002) g.Apples (Hemmat et al. 1994) h.Pineapples (Carlier et al. 2004)

A linkage map for European hazelnut (Corylus avellana L A linkage map for European hazelnut (Corylus avellana L.) was constructed using random amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) markers

Timelines

Please stop by my office if you have any questions. ALS 4021  Office Hours: Fridays, 1 - 2