DO Now- 2/27 Blonde hair is dominant to blonde hair. A heterozygous female is crossed with a heterozygous male… Punnett’s Square and phenotype/genotype ratios OR What is DNA? Where is DNA found?

TAKE YOUR MITOSIS PROJECTS HOME. I’m throwing them out tmw TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Zebrafish booklets and test: last day TODAY!

DNA (Deoxyribonucleic Acid)

Genetic material of cells… GENES – units of genetic material that CODES FOR A SPECIFIC TRAIT Called NUCLEIC ACIDS DNA is made up of repeating molecules called NUCLEOTIDES

ADENINE (A) – THYMINE (T) CYTOSINE (C) – GUANINE (G) DNA STRUCTURE DNA had specific pairing between the nitrogen bases: ADENINE (A) – THYMINE (T) CYTOSINE (C) – GUANINE (G) “Complementary Rule”: DNA made of 2 long stands of nucleotides arranged in a specific way

Nucleotides – DRAW THIS!!! Phosphate Nitrogenous Base (A, T, C, G) Sugar

Nitrogenous Bases PURINES 1. Adenine (A) 2. Guanine (G) PYRIMIDINES 3. Thymine (T) 4. Cytosine (C) A or G T or C

DNA Double Helix Nitrogenous Base (A,T,G or C) “Legs of ladder” “Rungs of ladder” “Legs of ladder” Phosphate & Sugar Backbone

P O 1 2 3 4 5 G C T A

Chargaff’s Rule Adenine must pair with Thymine Guanine must pair with Cytosine Their amounts in a given DNA molecule will be about the same. T A G C

BASE-PAIRINGS C G H-bonds T A

DNA Structure Review Questions What does DNA stand for? DNA is made of repeating units of __________________ A nucleotide is made of: …? Draw a nucleotide. What are the 4 nitrogenous bases? What are the two PURINES? Are they Big or little?

DO Now- 2/28 What makes up DNA? OR Draw a picture of what DNA looks like? What are the 4 bases?

TAKE YOUR MITOSIS PROJECTS HOME. I’m throwing them out tmw TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Students Run Quiz Thursday

A HISTORY OF DNA Discovery of the DNA double helix A. Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria (1928) B. Rosalind Franklin - X-ray photo of DNA. (1952) C. Watson and Crick - described the DNA molecule from Franklin’s X-ray. (1953)

History Continued Hershey & Chase– 1952, proved DNA determined proteins Used bacteria and bacteria viruses to show DNA responsible for heredity Chargaff—Chargaff’s rules. Using ratio of nitrogenous bases in DNA, showed complimentary bases.

Genetic Diversity… Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms.

The Code of Life… A T C G T A T G C G G… The “code” of the chromosome is the SPECIFIC ORDER that bases occur. A T C G T A T G C G G…

See p. 297 DNA is wrapped tightly around histones and coiled tightly to form chromosomes

#5  just the definitions of the 3 words Questions: Complete the questions on page 202 on a separate piece of paper (1 – 11). Please write the question and just your answer. Skip question 2 and 10 #5  just the definitions of the 3 words

Do Now – 3 /19 What is the structure of DNA? OR What are nucleotide bases?

STEP 1: Helicase unwinds, unzips STEP 2: DNA polymerase adds bases as it reads strand (leading and lagging strand) STEP 3: Ligase checks and binds all fragments together (finishing touch)

DNA Replication A-T, G-C DNA must be copied The DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A-T, G-C Replicates using the enzyme DNA polymerase

DNA Replication . Semiconservative Model: 1. Watson and Crick showed: the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand. . DNA Template New DNA Parental DNA

DNA Polymerase – Enzyme for DNA Replication Reads original strand 3’  5’ New strand created 5’  3’ DNA Helicase – Enzyme that unwinds the DNA

DRAW THIS!!!!!!!!!

(1961) Watson & Crick proposed… …DNA controlled cell function by serving as a template for PROTEIN structure. 3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) AMINO ACIDS are the building blocks of proteins.

Replication – Checking for Understanding 1. Why is replication necessary? 2. Who proposed the replication concept? 3. What is the replication process called? Use the complementary rule to create the complementary strand: A---? G---? C---? T---?

Questions: Answer the questions on page 200 (section 3 review) in your notebook I will check and grade them before you leave.

DNA Replication Review Question Draw a picture of DNA replication at the replication fork. What are the 2 enzymes involved in replication? What is DNA replication called (the name of the model proposed by Watson and Crick)? What is the difference between the leading and lagging strands? What is the complementary strand to the following: ATTAGCTAGGACT

EXIT TICKET 1. Draw a picture of a DNA strand. 2. Write the complementary strand to the following: AAATTTCCCGGG

Do Now – 3/9 What are the 3 parts of DNA What are the two enzymes in DNA replication? What is the shape of DNA CHOOSE ONE!!!!!!!

Define the words on page 221 on back of worksheet (Section 1 vocab) CLASSWORK 3/9 Define the words on page 221 on back of worksheet (Section 1 vocab) Any 6 questions from the worksheet Chapter 9

Do Now – 3/21 What are the 3 parts of DNA What are the 3 steps in DNA replication CHOOSE ONE!!!!!!!

Turn to page 202 in the Biology textbook Classwork: Turn to page 202 in the Biology textbook One a SEPARATE SHEET OF PAPER: Answer questions 2, 4, 5, and 8-15 You MUST write the question

DNA Transcription DNA can “unzip” itself and RNA nucleotides match up to the DNA strand. Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.

Transcription and Translation: An Overview (aka the Central Dogma) DNA RNA Protein Transcription Translation

RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base.

Transcription C-G A-U DNA  RNA Happens in the NUCLEUS RNA forms base pairs with DNA C-G A-U mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

Major players in transcription RNA polymerase- complex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides

mRNA Processing Primary transcript is not mature mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be spliced out before mRNA can leave nucleus

Translation Second stage of protein production mRNA is on a ribosomes in the cytoplasm tRNA brings amino acids to the ribosome

Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small Contain 3 binding sites E P A

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon

tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

The Genetic Code

ACGATA CCC TGA ATTGCGTTAGCTATCG UGC UAU GGG ACU UAA What would the amino acids be for the sequence above?

Transcription vs. Translation Review Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

Which codons code for which amino acids? Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of RNA that brings about transcription of a segment of RNA

DNA Translation The cell uses information from “messenger” RNA to produce proteins

Transcription/Translation Quiz Why is transcription necessary? Describe transcription. Why is translation necessary? Describe translation. What are the main differences between DNA and RNA. Using the chart on page 303, identify the amino acids coded for by these codons: UGGCAGUGC

1. Why is transcription necessary? Transcription makes messenger RNA (MRNA) to carry the code for proteins out of the nucleus to the ribosomes in the cytoplasm. 2. Describe transcription. RNA polymerase binds to DNA, separates the strands, then uses one strand as a template to assemble MRNA. 3. Why is translation necessary? Translation assures that the right amino acids are joined together by peptides to form the correct protein.

4. Describe translation. The cell uses information from MRNA to produce proteins. 5. What are the main differences between DNA and RNA. DNA has deoxyribose, RNA has ribose; DNA has 2 strands, RNA has one strand; DNA has thymine, RNA has uracil. Using the chart on page 303, identify the amino acids coded for by these codons: UGGCAGUGC tryptophan-glutamine-cysteine

(a library of about 1,000 books) AMAZING DNA FACTS… DNA from a single human cell extends in a single thread for almost 2 meters long!!! It contains information equal to some 600,000 printed pages of 500 words each!!! (a library of about 1,000 books)

LET’S REVIEW DNA… LM p.44 List the conclusions Griffith & Avery, Hershey & Chase drew from their experiments. Summarize the relationship between genes & DNA. Describe the overall structure of the DNA molecule. What are the 4 kinds of bases?