Next Generation Sequencing UNIVERSITA’ DEGLI STUDI DI NAPOLI Federico II FACOLTA’ DI MEDICINA E CHIRURGIA CORSO DI LAUREA in MEDICINA Anno Accademico 2014 – 2015 Next Generation Sequencing

Genomic Revolution Gene Expression Microarray Genome-wide Association Studies Next Generation Sequencing

In this Talk: Next generation sequencing (NGS) NGS applications Future directions We’ll talk about 2G and 3G I’ll mention 2 nice applications of NGS, one of them already in use the second is likely to become industrial in a few years period from now And finally I’ll mention some of the future directions, both in terms of technology developments and applications. 3

Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years 10 2001: Celera 100M$, 3 years 2007: 454 1M$, 3 months 8 2008: ABI SOLiD 60K$, 2 weeks 6 Log10(price) 2010: 5K$, a few days? 2009: Illumina, Helicos 40-50K$ I would like to begin with an overview of the history of human genome sequencing. Despite significant improvements … it was clear that Sanger sequencing would not make massive DNA sequencing at a low cost and high speed feasible. Several technologies were developed at the time, of which the 454 Life Sciences sequencer was the first to become commercial in 2005. 2 years later it was used for … Whether …, but the direction is clear: in a few years from now very fast and cheap sequencing technologies will be available for commercial and research purposes 4 2014: 2000$, Few days 2 2000 2005 2010 Year 4

Genome Sequencing Goal figuring the order of nucleotides across a genome determines the DNA sequence 5

Genome Sequencing AC..GC TT..TC CG..CA TG..GT TC..CC GA..GC TG..AC CT..TG GT..GC AT..AT TT..CC AA..GC Short DNA sequences Genome Short fragments of DNA ACGTGGTAA CGTATACAC TAGGCCATA GTAATGGCG CACCCTTAG TGGCGTATA CATA… ACGTGGTAATGGCGTATACACCCTTAGGCCATA ACGTGACCGGTACTGGTAACGTACA CCTACGTGACCGGTACTGGTAACGT ACGCCTACGTGACCGGTACTGGTAA CGTATACACGTGACCGGTACTGGTA ACGTACACCTACGTGACCGGTACTG GTAACGTACGCCTACGTGACCGGTA CTGGTAACGTATACCTCT... Sequenced genome 6 6

Sanger Sequencing Mix DNA with dNTPs and ddNTPs Amplify Run in Gel Fragments migrate distance that is proportional to their size 7

Sanger Sequencing 8

Sanger Sequencing Advantages Disadvantages Long reads (~900bps) Suitable for small projects Disadvantages Low throughput Expensive Speed Low resolution Scalability 9

Sanger Sequencing 2007: Global Ocean Sampling Expedition ~3,000 organisms, 7Gbp (Venter et al.) 1994: H. Influenzae 1.8 Mbp (Fleischmann et al.) 1980 1990 2000 1982: lambda virus DNA stretches up to 30-40Kbp (Sanger et al.) 2001: H. Sapiens, D. Melanogaster 3 Gbp (Venter et al.) 10

Next Generation Sequencing The ability to process millions of sequence reads in parallel It requires only one or two instruments runs to complete an experiments Genomic, transcripomic, epigenetic NGS is a general term refering to all post-Sanger sequencing technologies that enable massive sequencing at low cost. NGS may be further divided into polony-sequencing based technologies which require the amplification of DNA prior to sequencing, and single molecule sequencing which do not. Motivation for new technologies drives its roots not only from potentially commercial usage such as in personalised medicine, but also from government supported projects suce as the HGP or the 1000 genomes projects aiming to sequence the genomes of 1000 individuals around the world with price tag for genome sequencing single genomes set to 50,000$. other than de-novo sequencing Potential applications include re-sequencing, and also gene expression analysis, both can make use of short reads which are offered by all current technologies. So despite the read-length barrier of the new technologies, sequencers still became commercial. And of course – advancements in chemistry, microscopy and other related technologies enabled the new sequencing technologies. 12 12

Whole genome sequencing determines the complete DNA sequence of an organism's genome at a single time gDNA is first fragmented into a library of small segments that can be uniformly and accurately sequenced in millions of parallel reactions De novo sequencing Re-sequencing

Sample Multiplexing NGS reduces time to data for multiple samples

NGS vs Sanger sequencing

Types of next generation sequencing DNAseq Whole genome sequencing (WGS) Exome sequencing (1% protein coding portion of human genome) (WES) Targeted sequencing RNAseq – transcriptome: Truly accurate gene expression measurements Discover novel genes (and other kinds of RNA molecules) one experiment found that 34% of human transcripts were not from known genes Sultan et al, Science. 2008 Aug 15;321(5891):956-60. Chipseq Select (and identify) pieces of DNA that interact with specific proteins such as: Transcription factors Histones Methylation RNA Polymerase (survey actively transcribed portions of genome) DNA Polymerase (investigate DNA replication) DNA repair enzymes

Applications of Next Generation Sequencing Profiling of Variation Genetic variation Transcript variation Epigenetic variation Metagenomic variation Discovery Novel genomes Novel genes Novel transcripts Small / long non-coding RNA

Types of sequencer for NGS Evolving technology Illumina HiSeq 2000 Life Technologies SOLiD 4 Ion Torrent PGM Illumina MiSeq Pacific Biosciences RS Roche 454 GS FLX Roche GS Junior and then there is the bioinformatics

Next Generation Sequencing 454 Life Sciences/Roche Genome Sequencer FLX: currently produces 0.1GB bases per day per machine Published 1 million bases of Neanderthal DNA in 2006 May 2007 published complete genome of James Watson (3.2 billion bases ~20x coverage) Solexa/Illumina 10 GB per machine/week May 2008 published complete genomes for 3 hapmap subjects (14x coverage) ABI SOLID 20 GB per machine/week

454 First high-throughput DNA sequencer, commercially available in 2004 Now produces ~500 MB reads of 500 bp Run of 8 samples in 10 hours, so can do multiple runs/week Uses pyrosquencing, beads, and a microtiter plate Low error rate, but insert/delete problems

A parallelized version of pyrosequencing amplifies DNA inside water droplets in an oil solution (emulsion PCR) each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony. picolitre-volume wells each containing a single bead and sequencing enzymes

VIDEO 454 life

DNA Sequencing capability has grown exponentially DNA sequences in GenBank Doubling time = 18 months

Personalized medicine Goal Personalized medicine

Barack Obama announces Precision Medicine Initiative (PMI) national investment in research on approaches to disease treatment and prevention that take into account individual variability in each a) person's genes, b) environment, and c) lifestyle. So far identified: 3600 genes for rare mendelian disorders, 4000 genetic loci related to common diseases, and several hundred genes that drive cancer. FDA must evaluate diagnostic tests for both analytic validity and clinical validity

NGS Applications

Anthrax contamination Honey-bee epidemic … Emergency Genomics SARS virus Anthrax contamination Honey-bee epidemic … Next-Gen sequencing capability is a strategic necessity

Ancient DNA paleontology, anthropology, evolutionary biology, conservation biology, epidemiology Neandertal Tyrolean Iceman Woolly Mammoth Tasmanian wolf Pathogens Historical epidemics: flu, tuberculosis Origins of AIDS Cause of extinction in some species

Resequencing (mutation discovery/genotyping) A lot of current sequencing effort is spent on re-sequencing genomes of known species Individual humans (1000 Genomes Project) Experimental organisms – looking for genetic variation, copy number variation Challenge is to (quickly) align millions of sequence reads to a reference genome with some % of mismatches Challenge to accurately call SNPs and indels

to sequence the genomes of a large number of people, to provide a comprehensive resource on human genetic variation The goal of the 1000 Genomes Project is to find most genetic variants that have frequencies of at least 1% in the populations studied

Can very quickly sequence bacteria or viral isolates Pathogens Can very quickly sequence bacteria or viral isolates Identify strains – measure frequency in populations Can find rare variants in a mixed isolate (deep sequencing) Discover new strains – find precise mutations for drug resistance or increased virulence Cancer Sequence tumors from many patients for many different types of cancer

ICGC Marker Paper Nature 464, 993-998 (15 April 2010)

April 2010: World Map of Comprehensive Cancer Genome Projects Commitments for > 10,000 tumor genomes! New RFAs/projects in development

http://icgc.org

The results of this project could have enormous relevance to the health of people leading to personalized therapeutics

Lung cancer before and after Gefitinib EGFR inhibitor You have all probably seen this slide too! Lung cancer second most common cancer after breast One of lowest survival rates Genomics having some success already with treatments - gefitinib It acts on tumours over expressing EGFR and was approved by NICE in 2010 for lung cancer. There are now many other dramatic examples of targeted anti-tumour agents

BRAF inhibitors for Melanoma PET Before After Our understanding of cancer is evolving and improving all the time – but we need to do more Patient with severe melanoma BRAF inhibitors can improve quality of life and extend it but along way off finding cures

Metagenomics Survey/discovery all of the species present in an Environmental or Medical sample “Human Microbiome” disease vs. healthy microbe populations in mouth, intestines, skin, reproductive tract, etc Complete multiple genome sequencing Complete multi-species transcript profiling (metabolic reconstruction) Deep sampling of genetic variation in microbial populations (frequency of drug resistant, toxin producing, etc.)

Personalized Nutrition and The Human Microbiome Project (HPM) Direct and thorough examination of microbial communities has the potential to greatly improve human development, nutrition, physiology, and immunity. The next-generation sequencing technologies have inspired several studies of bacterial communities that reside on and in the human bodies

Example: Obesity It is associated with changes in the relative abundance of bacterial divisions in both human and moues gut traits The obese microbiome had an increased capacity to harvest energy from the diet The gut microbiota as an additional contributing factor to the balance of nutrition, which might have potential theraupetic impliactions Turnbaugh, et al. The human microbiome project. Nature 2007; 449: 804-810. Turnbaugh PJ, et al. An obesityassociated gut microbiome with increased capacity for energy harvest. Nature 2006; 444: 1027-1031.

HPM and Personalized nutrition New recommendations for food production, distribution and consumption in the future

Cleft palate, absent digits, ocular anomalies and others Exome sequencing A massively parallel short-read sequencer to sequence at 40 fold coverage Miller syndrome Cleft palate, absent digits, ocular anomalies and others

Exome sequencing and filtering strategy for rare mendelian disorders

eight candidate genes under a dominant model, and only one, DHODH, under a recessive model. The four individuals with Miller syndrome were found to have six rare variants in DHODH

This new approach will be critical to uncover the genes underlying rare mendelian traits, especially where the number of available individuals for study is small

Rare inherited diseases Work over the past 25 years: identification of genes for about 50% of the estimated 7,000 rare monogenic diseases By the year 2020 the remaining disease-causing genes will be identified The advent of NGS has changed the landscape of rare-genetic-disease research Rare disease may be rare but collectively they are very common and affect a significant number of the UK population Mainly affect children, only 50% are provided with a genomic diagnosis NIHR member of International Rare Disease Research Consortium

Pace of discovery of novel rare-disease-causing genes using whole-exome sequencing Of the more than 300 WES reports in the literature, ~15% that describe novel and distinct phenotypes for mutations in genes that were previously associated with a different rare disease

Paths forwards for rare-disease therapy In Europe: 144 medicinal products for treatment of 120 rare diseases. In USA: 340 medicinal products for the treatment of 355 different rare disease indications. This number will increase by NGS discoveries For instance Identification of mutations in riboflavin transporter genes SLC52A3 as the cause of Brown–Vialetto–Van Laere syndrome suggests that riboflavin could be used as treatment

Rate of approval of orphan drug products In Europe, there will be approximately 75 new approvals in the next 20 years

MiSeqDxTM Cystic Fibrosis Clinical Sequencing Assay The first FDA-cleared in vitro diagnostic next-generation sequencing assay to provide a complete view of the CFTR gene for increased confidence in cystic fibrosis variant detection.

Integrated Clinical Sequencing Assay

Visualization Using the MiSeq Reporter Software

China FDA Approves BGI NGS Assays Based on Ion Torrent and Complete Genomics NGS Technology The NGS systems have been approved in conjunction with BGI's noninvasive prenatal diagnostic kit, marketed as NON_INVASIVE_FETAL TRYSOMY_TEST (NIFTY), which screens for fetal aneuploidies in chromosomes 21, 18, and 13. Cell-Free Fetal DNA in maternal plasma and serum Short fragments of 145-200bp from placenta trophocytes Detectable in maternal plasma from the 5th week of gestation Disappears soon after childbirth

Future perspectives Limitation: lack of analyse and share deep phenotypic data and genomic-variation data on a large scale Human Variome Project: global initiative to collect and curate all human genetic variation affecting health, with the ultimate goal of reducing disease. International Standards for Cytogenomic Arrays Consortium collection of phenotypic data from patients investigated in more than 28,500 array-based studies PhenoDB and Pheno Tips free web tools contain clinical data and rare-disease-causing genes.

Future perspectives The medical geneticist of the NGS era will have an unprecedented opportunity to identify human disease-causing genes, enable the translation of NGS into diagnostic tools and understand the role of disease modifiers to advance the care of patients with rare diseases.

translation of gene discoveries Benefits to patients from elucidation of genetic basis of all rare genetic diseases Understanding molecular mechanisms Phenotypic heterogeneity Developing high-throughput or generalizable therapies for many diseases translation of gene discoveries

Predittiva, personalizzata, e preventiva Genomic Medicine Predittiva, personalizzata, e preventiva GRAZIE