Why is this useful for the prokaryote? Why can’t eukaryotes do this?

Slides:



Advertisements
Similar presentations
Proteins: Structure reflects function….. Fig. 5-UN1 Amino group Carboxyl group carbon.
Advertisements

Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand what would the mRNA strand be?
• Exam II Tuesday 5/10 – Bring a scantron with you!
5’ C 3’ OH (free) 1’ C 5’ PO4 (free) DNA is a linear polymer of nucleotide subunits joined together by phosphodiester bonds - covalent bonds between.
© 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition.
Unit 7 RNA, Protein Synthesis & Gene Expression Chapter 10-2, 10-3
How does DNA work? What is a gene?
Protein Synthesis. DNA RNA Proteins (Transcription) (Translation) DNA (genetic information stored in genes) RNA (working copies of genes) Proteins (functional.
CHAPTER 12 PROTEIN SYNTHESIS AND MUTATIONS -RNA -PROTEIN SYNTHESIS -MUTATIONS.
How Proteins Are Made Mrs. Wolfe. DNA: instructions for making proteins Proteins are built by the cell according to your DNA What kinds of proteins are.
PROTEIN SYNTHESIS NOTES #1. Review What is transcription? Copying of DNA onto mRNA Where does transcription occur? In the Nucleus When copying DNA onto.
© 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition.
LESSON 4: Using Bioinformatics to Analyze Protein Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research.
Learning Targets “I Can...” -State how many nucleotides make up a codon. -Use a codon chart to find the corresponding amino acid.
Fig Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon)
CELL REPRODUCTION: MITOSIS INTERPHASE: DNA replicates PROPHASE: Chromatin condenses into chromosomes, centrioles start migrating METAPHASE: chromosomes.
Place your keyboard aside. Only use the mouse.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
RNA 2 Translation.
DNA Pretest! Yes, I know I am a little late… Take out a separate sheet of paper Name Date Period DNA Pretest.
Transcription and Translation
CS273a A Zero-Knowledge Based Introduction to Biology Courtesy of George Asimenos.
Genomics Lecture 3 By Ms. Shumaila Azam. Proteins Proteins: large molecules composed of one or more chains of amino acids, polypeptides. Proteins are.
Gene Translation:RNA -> Protein How does a particular sequence of nucleotides specify a particular sequence of amino acids?nucleotidesamino acids The answer:
DNA Replication.
Amino acids.
Translation PROTEIN SYNTHESIS.
Whole process Step by step- from chromosomes to proteins.
Please turn in your homework
Protein Synthesis: Translation
Translation Tutorial Place your keyboard aside. Only use the mouse.
BIOLOGY 12 Protein Synthesis.
RNA Ribonucleic Acid.
Molecular Biology DNA Expression
BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW
I. Central Dogma "Central Dogma": Term coined by Francis Crick to explain how information flows in cells.
Transcription and Translation
Do now activity #2 Name all the DNA base pairs.
Ch 17 - From Gene to Protein
Warm Up.
Chapter 9 From DNA to Protein
Section 3-4: Translation
Translation Tutorial Place your keyboard aside. Only use the mouse.
Translation Tutorial Place your keyboard aside. Only use the mouse.
Insert Fig CO 8.
The genetic code © 2016 Paul Billiet ODWS.
PROTEIN SYNTHESIS.
20.2 Gene Expression & Protein Synthesis
Fig. 5-UN1  carbon Amino group Carboxyl group.
Mutations are changes in the genetic material of a cell or virus
Transcription and Translation
Transcription and Translation
Today’s notes from the student table Something to write with
Proteins Genetic information in DNA codes specifically for the production of proteins Cells have thousands of different proteins, each with a specific.
Translation Tutorial Place your keyboard aside. Only use the mouse.
The 20 amino acids.
Do now activity #6 What is the definition of: RNA?
Translation.
Replication, Transcription, Translation PRACTICE
The 20 amino acids.
Do now activity #5 How many strands are there in DNA?
Unit 7 Part 2 Notes: From Gene to Protein
Replication, Transcription, Translation PRACTICE
Replication, Transcription, Translation PRACTICE
Example of regression by RBF-ANN
Protein Synthesis Learning Outcomes – B7 and B8
“When you understand the amino acids,
Gene Expression How proteins are made..
12.2 Replication of DNA DNA replication is the process of copying a DNA molecule. Semiconservative replication - each strand of the original double helix.
DNA & Translation.
Presentation transcript:

Why is this useful for the prokaryote? Why can’t eukaryotes do this? Peer Instruction 5 end of mRNA 1 2 3 Protein Ribosome RNA polymerase (3 end of template strand) Start of gene End of gene (5 end of What is happening? Why is this useful for the prokaryote? Why can’t eukaryotes do this?

What is a disadvantage of the eukaryotic system? Peer Instruction What is a disadvantage of the eukaryotic system? What is an advantage of the eukaryotic system? mRNA Transcription and RNA processing in nucleus DNA Mature mRNA Mature mRNA Translation in cytoplasm Ribosome Protein

What is going on here, and why? (not covered in your reading…) The following structure is sometimes found in the cytoplasm of a eukaryotic cell. Peer Instruction A ‘guide’ protein that binds to both ends of the RNA What is going on here, and why? 5’ cap A ribosome PolyA tail An RNA molecule Hint: Only one molecule is really moving… A new protein

After this class, you should be able to: Monday January 23rd, 2017 Class 13 Learning Goals Genetic Codes After this class, you should be able to: Read and use a codon table for nearly every organism on Earth Decode an open reading frame of DNA: When given the frame When you know that there is a start codon somewhere On double-stranded DNA Describe the advantages and disadvantages of coupling between transcription and translation in prokaryotes

Codon tables Notice the redundancies SECOND BASE FIRST BASE Phenylalanine (Phe) Leucine (Leu) Isoleucine (Ile) Methionine (Met) (Start codon) Valine (Val) Alanine (Ala) Threonine (Thr) Proline (Pro) Serine (Ser) Tyrosine (Tyr) Stop codon Histidine (His) Glutamine (Glu) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) Glycine (Gly) Arginine (Arg) Tryptophan (Trp) Cysteine (Cys) THIRD BASE Notice the redundancies (mostly, but not always, in the 3rd position)

In the diagram shown, what represents DNA? Peer Instruction What competitive disadvantage would you expect for a species that used a 2-base code? A 4-base code? In the diagram shown, what represents DNA? 3 5 -35 -10 +1 TAC 5 3 AUG UAG Do you think biologists are consistent in how they represent genes? N C

5’ – AUG-UAC-GGC-CCU-UAA-3’ Peer Instruction This RNA sequence starts from the start codon. Translate this sequence using the codon table. 5’ – AUG-UAC-GGC-CCU-UAA-3’ SECOND BASE FIRST BASE Phenylalanine (Phe) Leucine (Leu) Isoleucine (Ile) Methionine (Met) (Start codon) Valine (Val) Alanine (Ala) Threonine (Thr) Proline (Pro) Serine (Ser) Tyrosine (Tyr) Stop codon Histidine (His) Glutamine (Glu) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) Glycine (Gly) Arginine (Arg) Tryptophan (Trp) Cysteine (Cys) THIRD BASE N-Met-Tyr-Gly-Pro-STOP-C N-Met-Met-Pro-Gly-C N-Tyr-Gly-Pro-C N-Met-Tyr-Gly-Pro-C

Here is a piece of DNA. There is only one start codon. Translate! Peer Instruction Here is a piece of DNA. There is only one start codon. Translate! 5’–ATCTTAGCGGGAATTCATAGTC-3’ 5’–TAGAATCGCCCTTAAGTATCAG-3’ SECOND BASE FIRST BASE Phenylalanine (Phe) Leucine (Leu) Isoleucine (Ile) Methionine (Met) (Start codon) Valine (Val) Alanine (Ala) Threonine (Thr) Proline (Pro) Serine (Ser) Tyrosine (Tyr) Stop codon Histidine (His) Glutamine (Glu) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) Glycine (Gly) Arginine (Arg) Tryptophan (Trp) Cysteine (Cys) THIRD BASE Answer = 1

5’–AATGAAGCGGGAATTCTAAGTC-3’ Peer Instruction What are the pieces of information that you need to be able to translate from any piece of DNA? Often, molecular biologists will say something like: “Please translate the sequence shown”. What is the incorrect assumption in this request? 5’–AATGAAGCGGGAATTCTAAGTC-3’ Answer = 1 Imagine that this DNA is in an open reading frame. How many possible protein sequences could be encoded here? 5’–AACGAAGCG-3’ 3’–TTGCTTCGC-5’

In which direction does the RNA polymerase enzyme move? Peer Instruction Where does sigma bind? In which direction does the RNA polymerase enzyme move? Termination signal for mRNA H ‘5 ‘3 -35 -10 +1 Promoter H CCACTTTAAGAAGTCCCCTCAATGGGACATGCGCAAACCAGGCGCTGAAG GGTGAAATTCTTCAGGGGAGTTATCCTGTACGCGTTTGGTCCGCGACTTC Where does the new RNA start and end?

1: 5’-NNNNNNNNNNNNNCUUCAGC :20 21: GCCUGGUUUGCGCAUGUCCU :40 CCACTTTAAGAAGTCCCCTCAATGGGACATGCGCAAACCAGGCGCTGAAG GGTGAAATTCTTCAGGGGAGTTATCCTGTACGCGTTTGGTCCGCGACTTC Termination signal for mRNA H ‘5 ‘3 -35 -10 +1 Promoter H Peer Instruction This gene encodes the mRNA sequence shown. 1: 5’-NNNNNNNNNNNNNCUUCAGC :20 21: GCCUGGUUUGCGCAUGUCCU :40 41: AUUGAGGGGACUUCUUAAAG :60 61: UGGNNNNNNN-3’ Where is the Start Codon? How long is the encoded protein?

Concept Questions A single-celled eukaryote produces proteins more slowly than bacteria of similar size. Why is this lack of coupling an advantage in highly mutagenic environments? Why does the bacteria have an advantage in dark ocean-bottom environments with sporadic food surpluses? Create a random stretch of DNA of 40 bases long. Translate in each direction as if the AUG was oriented to start the open reading frame at the 5’ end. Then, retranslate by finding any start codons. Do you have any unnecessary STOP codons in this DNA? From your DNA, change the sequence to make it encode a 3-amino-acid protein. Do this with the least changes possible.

After this class, you should be able to: Tuesday January 24th, 2017 Class 13 Learning Goals Mutations After this class, you should be able to: Assess whether or not a molecule is a likely mutagen based on specific chemical effects Classify point mutations based on changes to a protein product Predict the outcome of two different point mutations and infer which would likely have more influence on organism fitness Predict relative effects of point mutations and chromosomal-scale mutations for organisms or cells Define a gene

What is a point mutation? Peer Instruction What is a point mutation? Examine the following changes. Does each change many proteins, change one protein, or have no impact? Δ in the DNA of a skin cell Δ in the DNA of a sperm cell Δ in a protein in a sperm cell Δ in an mRNA in a skin cell Which of these changes can impact fitness? Which of these changes is heritable?

Is this a normal human karyotype? Peer Instruction Is this a normal human karyotype? Duesberg et al. paper 2005; breast cancer cell line Non-normal = lots of aneuploidy (e.g. 3, 5, 6, 9, 10 …) MANY translocations Missing chromosomes (e.g. 2, 15, X or Y) For a difference that you noticed: How many genes did this change impact?

Peer Instruction Match the following mutation types to the genes from the information found in this example: Genes: Regulatory enzyme Structural protein Ribosome factor ATP producer Mutation Type: Deletion Frameshift Insertion Missense Synonymous

Peer Instruction It would be helpful to define a gene. What would we need to include in a robust definition?

A working definition of the “gene”. A gene is a unit of genetic material that encodes the information necessary to produce one protein. Usually DNA Not necessarily continuous Often guided by a promoter region

Concept Questions Create a random stretch of protein-coding DNA. Flip a coin, and if heads imagine that the promoter is on the left (and add the DNA needed to encode a start codon there as well). Pick any single base, and predict the mutation class: If you remove the base If you replace the base with two As Change the base to a different base Which of these changes for your DNA is most likely to destroy function of the protein? Why are prenatal doctors much more likely to test for small chromosomal breakages than for point mutations of 5-20 bases? Which is more likely to be mutagenic: A cosmic ray that only changes A’s to U’s in DNA A radioactive isotope that changes tyrosines to phenyalanines in proteins An enzyme that can replace the DNA sequence ‘AGCGAGGTT’ with ‘AGTTAGGTT’

Here is section of double-stranded DNA. Assuming all possible mRNAs are made, which protein sequence or sequences will be created? 5-ACTAATGAGACCAGTATCATGTTAACG-3 3-TGAATACTCTGGTCATAGTACAATTGC-5 A 6-amino-acid protein A 5-amino-acid protein A 4-amino-acid protein A 6-amino-acid protein and a 5-amino-acid protein A 5-amino-acid protein and a 4-amino-acid protein A 6-amino-acid protein and a 4-amino-acid protein Answer is 4

Peer Instruction Match the following mutation types to the mutations found in this example: Genes: Regulatory enzyme Structural protein Ribosome factor ATP producer Mutation Type: Deletion Frameshift Insertion Missense Synonymous

After this class, you should be able to: Wednesday, January 25th, 2017 Class 14 Learning Goals DNA Replication After this class, you should be able to: Describe the genome-wide process of initiation of DNA replication Define the role and predict a loss-of-function mutation result for each of the enzymes involved in replication Given a diagram of replicating DNA, locate likely sites of action for each enzyme involved in replication Assign descriptive terms appropriately to replication on the leading or lagging strands of a particular replication fork By the end of this first half of the class, you’ll have an understanding of what these images are trying to describe.

A chromosome being replicated Peer Instruction A chromosome being replicated Circular chromosomes (like in prokaryotes) Old DNA New DNA Origin of replication Replication bubble Linear chromosomes (like most eukaryotes) 3 5 3 5 3 5 5 Old DNA 3 New DNA Replication fork What is an ‘origin’? Why do eukaryotic chromosomes have multiple origins? Why is replication able to go in both directions?

Why can’t DNA replication start without a primer? Peer Instruction Primase synthesizes RNA primer (supplying a 3’ OH) Topoisomerase relieves twisting forces 5 3 5 Helicase opens double helix Single-strand DNA-binding proteins (SSBP) Why can’t DNA replication start without a primer? Why is ssBP important? What would be the phenotype of a mutation in: Topoisomerase Helicase

The sliding clamp has no effect on DNA pol’s ability to Peer Instruction Leading strand Sliding clamp holds DNA polymerase III in place 3 5 RNA primer 5 The sliding clamp has no effect on DNA pol’s ability to catalyze one reaction. What does the sliding clamp do? Why is this called the ‘leading’ strand?

the replication fork moving? the polymerase on this strand moving? Peer Instruction In which direction is: the replication fork moving? the polymerase on this strand moving? What is the engineering problem faced by the enzymes on the lagging strand? RNA primer 5 3 5 Topoisomerase SSBPs Primase Helicase

Describe the mechanisms shown here. Peer Instruction 5 3 Sliding clamp Okazaki fragment 3 5 5 DNA polymerase III 5 3 Okazaki fragment Okazaki fragment 5 3 5

What is DNA polymerase I doing? Peer Instruction 5 3 DNA polymerase I 3 5 5 What is DNA polymerase I doing? 5 3 DNA ligase 5 3 5 What would be the phenotype of a deleterious mutation in the ligase-encoding gene?

Homework: Replication Enzymes Chart Function Location Mutation Effects? ssDBP Topoisomerase Helicase DNA Polymerase I DNA Polymerase III Sliding Clamp Primase Ligase

Concept Questions How does replication begin on a single small linear chromosome? What proteins are used? How would this be different for an extremely large circular chromosome? Complete the given chart for the enzymes involved in replication. For each enzyme, be able to justify the evolutionary advantage and protein cost of the enzyme. Draw an upside down ‘Y’. Assume that the tail of the ‘Y’ is double stranded DNA. Fill in the locations of all of the enzymes from the chart based on where they are likely to act. You can assume that each arm of the ‘Y’ is 500 bases long and that an Okazaki fragment is 150 bases long on average. When finished, complete the replication bubble with the other fork. Which strand (leading or lagging) is best characterized as: Simple? Likely to have mutations? More complicated in terms of enzymes Likely to have a very long new strand Bonus: Slower?