Protein Synthesis (DNA Transcription and Translation) Sections 12.3 & 12.4 Pages 336-349

What is a Gene? Pg. 336 Gene: a segment of DNA that codes for a specific protein The Central Dogma of Biology: DNA codes for RNA and RNA makes protein (the synthesis of) Transcription ^ Translation ^

One gene codes for one polypeptide → Pg. 336 One gene codes for one polypeptide → polypeptide - a chain of bonded amino acids A polypeptide forms a protein

Let’s make some observations about RNA’s structure …

RNA RNA stands for: RNA is found in the: Ribonucleic acid Pg. 336 RNA RNA stands for: Ribonucleic acid RNA is found in the: Nucleus and Cytoplasm

RNA Structure Made up of nucleotides (just like DNA) Pg. 336 Made up of nucleotides (just like DNA) Each nucleotide consists of a: Sugar (ribose) Phosphate Nitrogen Base Single Stranded! Many different shapes and lengths

RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U) Pg. 336 RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U)

There are 3 types of RNA: Page. 336 Pg. 336 There are 3 types of RNA: Messenger RNA (mRNA) – a long strand of RNA nucleotides that are formed complementary to one strand of DNA. Carries genetic information from DNA in the nucleus to Ribosome in the cytoplasm. Page. 336

Pg. 336 2. Ribosomal RNA (rRNA) – associates with a protein to form the ribosome

Pg. 336 3. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.

Do Now Fill in chart below: DNA RNA Structure Sugar Base Example strand: Complementary: TACGA

Do Now What are the three types of RNA? What is the purpose of each? What is the Central Dogma?

So how do we make a protein? Pg. 336 So how do we make a protein? Step 1: a segment of DNA needs to be copied into an RNA strand, known as transcription. STEP 1: Transcription

Transcription Location: Nucleus First step in making a protein Pg. 337 Location: Nucleus First step in making a protein Process of taking one gene (DNA) and converting into a mRNA strand

Steps to Transcription 1. An enzyme (RNA polymerase) attaches to the promoter (start signal region) of a gene and unwinds the DNA

Steps to Transcription (Cont.) 2. One strand acts as a template.

Steps to Transcription (Cont.) 3. A mRNA copy is made from the DNA template strand by RNA polymerase 4. mRNA is made until it reaches the termination (stop signal) sequence 5. mRNA is released and the two strands of DNA rejoin.

Template vs. Non Template Strand

Transcription animations and Videos

Transcribe this DNA to mRNA Template Strand

Label the Transcription diagram Template Strand B. Non-Template Strand C. RNA Nucleotides D. mRNA E. RNA Polymerase

mRNA Processing Pg. 337 Pre-mRNA – the original sequence of RNA created during transcription mRNA reaches the ribosomes

RNA Processing cont... In Eukaryotes only Introns- non-coded sections (a.k.a “Junk” DNA) Exons- codes for a protein

RNA Processing cont... Before RNA leaves the nucleus, introns are removed and exons are spliced together A 5’cap and poly A tail are added to ends of the sequence mRNA leaves the nucleus through the nuclear pores

Why is it necessary to add the poly A tail and 5’ cap? Keeps mRNA from degradation, and helps mRNA bind to ribosome.

Let’s try an example… Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Transcribe it 3’ CAUGAUGUACGAUACGUA 5’ Add the 5’ cap: 3’ CAUGAUGUACGAUACGUA 5’ cap

Finish the job! Add a poly A tail onto the 3’ end Remove the introns “UGUA” and “AUAC”: 3’ CAUGAUGUACGAUACGUA 5’ cap 3’ CAUGACGGUA 5’ cap Add a poly A tail onto the 3’ end 3’AAAAACAUGACGGUA 5’ cap

Do Now 5’ T A C C G G T A C A G T G 3’ 3’ A T G G C C A T G T C A C 5’ What is the purpose of transcription? Where does it start and end? What enzyme is involved? Perform transcription below: (Template) 5’ T A C C G G T A C A G T G 3’ 3’ A T G G C C A T G T C A C 5’ What direction did transcription occur?

Try another problem! Complete transcription and RNA processing for the following: DNA Strand of non-template strand: 5’ ATCGGTAGAGTATTTACAGATA 3’ Remove introns: CGGUA UUACAG

Converting RNA into a Protein Pg. 338 Converting RNA into a Protein Step 2: The RNA strand is decoded and produces a specific protein, known as translation. STEP 2: Translation

Proteins -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains https://www.youtube.com/watch?v=qBRFIMcxZNM

How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins

Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

Do Now What bonds connect those subunits? Where are proteins made? What subunits are proteins made of? What bonds connect those subunits? Where are proteins made? What are the 3 mains parts to protein synthesis (making of proteins)?

Translation Pg. 338 mRNA goes to the ribosomes in the cytoplasm or the RoughER and produces proteins Three main stages: Initiation Elongation Termination

Pg. 339 Pg. 339

Ribosome Two subunits to the ribosome Large AND small 3 sites on the ribosome (A, P, E ) A: tRNA binding site P: polypeptide bonding site E: exit site

Steps to Translation Initiation: Pg. 338 1. mRNA binds to a ribosome in the cytoplasm 2. The two ribosomal subunits come together at the 5’ end of the mRNA. 3. Ribosome will find the start Codon (AUG) and the first tRNA molecule will attach This is the only tRNA that will attach to the P site (and skip the A site) The first amino acid is always methionine.

What is a codon? Pg. 338 Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

Start and Stop Codons Start Codon - AUG Stop Codons - UGA, UAG, & UAA Pg. 338 Start Codon - AUG Stop Codons - UGA, UAG, & UAA

Think-Pair-Share The mRNA sequence reads the following codons: What amino acids do they stand for? AUG GGA GAG CAA

Do Now: DNA Template: 3’ CGACTACCAGAGACATTACAATCATTAAACG 5’ Transcribe: RNA Processing: Intron: AAUG Translate:

tRNA tRNA has an anticodon that matches the codon on the mRNA strand Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

Steps to Translation (Cont.) Pg. 338 Elongation: 4. Amino acids attached to a tRNA molecules are brought over to the mRNA, and load in at the A site of the ribosome. 5. A polypeptide bond is formed between the amino acids in the P and A sites of ribosome. 6. Ribosome shifts over, opening up the A site for a new tRNA molecule. 7. tRNA in the E site leaves, leaving behind the amino acid.

Steps to Translation (Cont.) Pg. 338 Termination: 8.Translation is terminated when a stop codon is reached. There are three different stop codons UGA, UAA, UAG. 9. The release factor recognizes the stop codon, attaches to the mRNA strand in the A site of ribosome, and releases the polypeptide strand. All the factors break apart and can be reused again.

Translation Animations Video 1 Video 2

Think – Pair - Share Find the amino acid sequence for the following mRNA sequence (translation) AUGCGACGAAUUUAA

Do Now Conduct transcription and translation (remember start and stop codons!) DNA: 3’ TTTTATACTGAGGGTTAACTCGT 5’ mRNA: tRNA: AA:

Challenge Question Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA). Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop What do you notice about your DNA sequences?

Do Now: 1. What is lactase persistence? 2. Who is lactase persistent? 3. Why is lactase persistence beneficial? 4. Explain WHY most people are lactase persistent.

Mistakes in DNA Cell make mistakes in replication, and transcription Pg. 345 Mistakes in DNA Cell make mistakes in replication, and transcription Most often these mistakes are fixed When these mistakes aren’t fixed, it causes a mutation. A permanent change that occurs in a cell’s DNA is called a mutation.

Point Mutation Pg. 346 Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed to a stop codon Cause translation to terminate early. Usually leads to proteins that can’t function normally. Silent Mutation: change codes for same amino acid and cause no change in protein produced.

Frameshift Mutations Pg. 346 Causes the reading frame to shift to the left or right Insertion: Addition of a nucleotide Deletion: Removal of a nucleotide

ACGAAATACAGACATATT Decide what type of mutation occurred: ACGAAATACATACATATT ACGAAATACAGAATATT ACGAAATACAGGACATATT ACGAAATACAGTCATATT

Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic. Pg. 348

Sex Cell vs. Somatic Cell Mutations Pg. 349 Somatic cell mutations are not passed on to the next generation. Mutations that occur in sex cells (gamete cells) are passed on to the organism’s offspring and will be present in every cell of the offspring

Chromosomal Mutations Pg. 347 Inversion: Piece of chromosome can be broken off, duplicated, or moved to another chromosome

Sickle Cell Anemia What type of mutation?

Mutation Videos Video 1 Video 2 Video 3