Big Data in Genomics, Diagnostics, and Precision Medicine

Slides:

Advertisements

Similar presentations

Test-tube or keyboard? Computation in the life sciences.

Advertisements

James R. Rigas Comprehensive Thoracic Oncology Program

Zeroing in on Non-Small Cell Lung Cancer: Integrating Targeted Therapies into Practice.

Shyamala Maherswaran, Ph.D. et al. Sarah Gomez and Rachael Holmes Detection of Mutations in EGFR in Circulating Lung-Cancer Cells.

Clinical Implementation of Genomic Cancer Medicine

Bioinformatics at Molecular Epidemiology - new tools for identifying indels in sequencing data Kai Ye

Recommendations from HL7 Clinical Genomics & Anatomic Pathology Workgroups, NCBI, and LOINC/Lister Hill Center at NLM To the College of American Pathologists.

Tumour karyotype Spectral karyotyping showing chromosomal aberrations in cancer cell lines.

Molecular Testing of lung cancer in routine practice

Detection of Mutations in EGFR in Circulating Lung-Cancer Cells Colin Reisterer and Nick Swenson S. Maheswaran et al. The New England Journal of Medicine.

Precision Medicine: From stratified therapies to personalized therapies Fabrice ANDRE Institut Gustave Roussy Villejuif, France.

Curing Carcinoid From genes to drugs: Finding the genes Matthew Meyerson, M.D., Ph.D. Dana-Farber Cancer Institute Boston, Massachusetts.

Mechanisms of Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors (EGFR-TKI) in Non-Small Cell Lung Cancer (NSCLC) Victor.

Prognose mittels Genexpression Prof. Martin H. Brutsche Kantonsspital St. Gallen-CH.

Gene Therapy AP Biology Unit 2 + What is Gene Therapy? A way to treat or cure diseases by inserting the “correct” DNA into the cell. Most promising for.

Development of Molecular Methodologies for the Enhanced Detection of Tumour Biomarkers Michelle Wood, Hood Mugalassi, Justyna Tull, Linda Meredith, Rachel.

Activity and Tolerability of Afatinib (BIBW 2992) and Cetuximab in NSCLC Patients with Acquired Resistance to Erlotinib or Gefitinib Janjigian YY et al.

Surrogate or Not: The Role for Cell Free Circulating DNA in Detecting EGFR Mutations Present in Tumor Tissue S. Das 1, L. Bazhenova 2, V. Singh 3, L. Arnold.

DNA Technology. TO DO HUMAN GENOME PROJECT Started in map the 3 billion nucleotide sequencesThe project’s purpose was to discover all the estimated.

CAP Cancer BioMarker Reporting Committee Biomarker - Problem, ROI and Scope College of American Pathologists’ Biomarker Reporting Committee Problem 1.Clinicians.

CtDNA NGS testing identified a high-level MET amplification (copy number of 53.6 in circulation) (Figure 1A). The test was repeated on a second tube of.

Anna Buder Institute of Cancer Research Department of Medicine I Medical University of Vienna Liquid Biopsies Analysis of circulating cell-free tumor-DNA.

Emerging Genomic Technologies: Extending the Application of Genomics to Prediction, Diagnosis, Monitoring, and Early Detection Luis A. Diaz, M.D. Johns.

A Sensitive Method for Detecting EGFR Mutations in Non-small Cell Lung Cancer Samples with Few Tumor Cells Miguel A. Molina-Vila, PhD, Jordi Bertran-Alamillo,

Samsung Genome Institute Samsung Medical Center

Epidermal growth factor receptor tyrosine kinase inhibitors as initial therapy for non- small cell lung cancer: Focus on epidermal growth factor receptor.

Genomon a high-integrity pipeline for cancer genome and transcriptome sequence analysis Kenichi Chiba(1), Yuichi Shiraishi(1), Ai Okada(1), Hiroko.

Precision Medicine: The Potential for Identifying Personalized Therapies for Patients with Gastro-Esophageal Cancer.

Synthetic Circulating Cell-free DNA as Quality Control Materials for Somatic Mutation Detection in Liquid Biopsy for Cancer R. Zhang, R. Peng, Z. Li, P.

Jeopardy Testing 1, 2, 3 She Has The Cancer Radiation or Chemo?

Application of a Highly Sensitive Detection System for Epidermal Growth Factor Receptor Mutations in Plasma DNA Tomomi Nakamura, MD, Naoko Sueoka-Aragane,

Presented By John Bartlett at 2017 ASCO Annual Meeting

Patient Case 1 Patient Case 1: PET/CT Scan.

Crystal digital PCR for detection and quantification of circulating EGFR mutations in advanced non-small cell lung cancer Cécile Jovelet Postdocoral fellow.

Yes, Patient #1 Yes, Patient #3 EGFR sequencing chromatograms

A Targeted High-Throughput Next-Generation Sequencing Panel for Clinical Screening of Mutations, Gene Amplifications, and Fusions in Solid Tumors Rajyalakshmi.

Application of a Highly Sensitive Detection System for Epidermal Growth Factor Receptor Mutations in Plasma DNA Tomomi Nakamura, MD, Naoko Sueoka-Aragane,

The Genomics of Cancer and Molecular Testing:

Regulatory Industry Statistics Workshop 2018

EGFR Array: Uses in the Detection of Plasma EGFR Mutations in Non–Small Cell Lung Cancer Patients Irene Yam, BSc, David Chi-Leung Lam, MBBS, PhD, Kaimin.

Adrian G. Sacher, MD, Kimberly M. Komatsubara, MD, Geoffrey R

Monitoring EGFR mutation status in Non-small cell lung cancer (NSCLC) patients using circulating Tumour DNA (ctDNA). Matthew Smith Molecular Pathology.

Carlos L. Arteaga, Jeffrey A. Engelman Cancer Cell

Introduction. For Pulmonologists by Pulmonologists: Diagnosis of NSCLC in an Age of Biomarkers.

An Alternative Method for Screening EGFR Mutation Using RFLP in Non-small Cell Lung Cancer Patients Ichiro Kawada, MD, Kenzo Soejima, MD, PhD, Hideo.

T790M Mutation-Positive NSCLC: A Multidisciplinary Case Conference

EGFR Inhibitors in Advanced NSCLC: Who, When, and Why?

A Sensitive Method for Detecting EGFR Mutations in Non-small Cell Lung Cancer Samples with Few Tumor Cells Miguel A. Molina-Vila, PhD, Jordi Bertran-Alamillo,

Figure 1 The dynamic nature of resistance mechanisms can be

Beyond Erlotinib: Better EGFR Inhibitors?

Assessment of EGFR Mutation Status in Lung Adenocarcinoma by Immunohistochemistry Using Antibodies Specific to the Two Major Forms of Mutant EGFR Marie.

How will cancer be treated in the 21st century?

Inherited Germline T790M Mutation and Somatic Epidermal Growth Factor Receptor Mutations in Non-small Cell Lung Cancer Patients Carmelo Tibaldi, MD,

Detection rate for EGFR mutations in cfDNA.

Highly Sensitive Droplet Digital PCR Method for Detection of EGFR-Activating Mutations in Plasma Cell–Free DNA from Patients with Advanced Non–Small Cell.

Cancer WGS Analytical Pipeline Validation

A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer Yasushi Yatabe, Toyoaki Hida, Yoshitsugu Horio, Takayuki.

Jamie A. Saxon, PhD, Lynette M. Sholl, MD, Pasi A. Jänne, MD, PhD

Coexistence of Tyrosine Kinase Inhibitor-Sensitizing and Resistant EGFR Mutations in an Untreated Lung Adenocarcinoma Patient and Response to Erlotinib

Quality Improvement and Molecular Profiling in Advanced Non-Small Cell Lung Cancer.

EGFR Mutations Detected in Plasma Are Associated with Patient Outcomes in Erlotinib Plus Docetaxel-Treated Non-small Cell Lung Cancer Philip C. Mack,

A Platform for Rapid Detection of Multiple Oncogenic Mutations With Relevance to Targeted Therapy in Non–Small-Cell Lung Cancer Zengliu Su, Dora Dias-Santagata,

XL647—A Multitargeted Tyrosine Kinase Inhibitor: Results of a Phase II Study in Subjects with Non-small Cell Lung Cancer Who Have Progressed after Responding.

Rapid Polymerase Chain Reaction-Based Detection of Epidermal Growth Factor Receptor Gene Mutations in Lung Adenocarcinomas Qiulu Pan, William Pao, Marc.

Rapid Detection of Hotspot Mutations in Epidermal Growth Factor Receptor by Polymerase Chain Reaction Facilitates the Management of Non-small Cell Lung.

Highly Sensitive Detection of EGFR T790M Mutation in Pre-TKI Specimens of EGFR- Mutated NSCLC: In Cis, In Trans, or a Different Clone? Alvaro Leone, BSc.D

What's on the Horizon in the Management of EGFR-Mutated Lung Cancer?

Representative examples of estrogen receptor α and β immunohistochemical expression (top figures) and EGFR mutations (bottom figures) in lung adenocarcinomas.

Location of common clinically relevant mutations in EGFR

Presentation transcript:

Big Data in Genomics, Diagnostics, and Precision Medicine James Han

3 billion bases in Human genome decoded. 1990 to 2001

= + Cost of sequencing 1st human genome -> today $2.7B -> $1,500 15 years -> 1 week International team of scientists from 20+ institutions -> 1 person Sequencing technologies Bioinformatics - New applications - Fast and memory efficient algorithms + =

The Genome Project and sequencing are driving cancer research Increasing number of associations between the genome and cancer. New sequencing technology Human genome start Human genome complete

Typical sequencing runs from different technologies Bases of sequence (max) 1800 Gb 16 Gb 1G Read length (max) 150 bp 400 bp >20,000 bp Error rate 0.1% 10%

Tissue based sequencing diagnostics Tumor Sequence Therapy Identify tumor Tumor tissue Tumor DNA + Clinical Trials Medical literature

Personalized medicine in lung cancer Common EGFR mutations and implications for Erlotinib response 10-35% of non-small cell lung cancer patients have a mutation in EGFR Erlotinib Greater resistance to Erlotinib T790M Greater sensitivity to Erlotinib Exon 19 deletion G719 L858R T790M mutation infers with proper binding of the Erlotinib

Cancer mutations detected from millions of sequencings reads @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT Sequence manipulation, signal processing, statistical modeling Using computationally efficient algorithms Somatic SNV Small In/Del Structural Variation Normal

Tumor-specific aberrations in liquid biopsy

Source: nytimes

Clinical quality big data technologies Healthcare @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT This person has stage 3 Non-small cell lung cancer. Based on her genomic data, she should be treated with Erlotinib. Confidence: 90%

Thank You.