Fall 2016 - HORT6033 Molecular Plant Breeding Instructor: Ainong Shi

Fall 2016 - HORT6033 Molecular Plant Breeding Lecture 3 SSR (08/26/2016) Class PCR and Primer Design SSR SSRLocator Homework Questions

SSR Marker and Tools After PCR, the DNA sample with Allele #1, #2, #3 SSR is repeating sequences of 2-5 (most of them) base pairs of DNA such as (AT)n, (CTC)n, (GAGT)n, (CTCGA)n SSR is called Microsatellite SSR usually is co-dominant SSR can be used: Fingerprinting Genetic diversity Genetic mapping Association mapping Marker-assisted selection Genome-wide selection etc. Left Figure: Allele #1: (CA)11 [SSR motif (CA) repeat 11 times] Allele #2: (CA)13 Allele #3: (CA)16 After PCR, the DNA sample with Allele #1, #2, #3 showing different size DNA fragment and the different combination of allele #1, #2, and #3 with different pattern with co-dominant. (image from http://www.cdfd.org.in/)

Example for SSR (AT) from BatchPrimer3

SSRLocator SSR discovery for large DNA sequences, and also for primer design and PCR simulation (Maia et al. 2008. Int J Plant Genomics. 2008:412696) [PDF] Tools: http://www.microsatellite.org/ Example: cowpea_EST_1_0693.fasta (linked)

Download and Install SSRLocator Download SSRLocator and Firebird at http://cgfufpel.org/ssrlocator_pt.htm . Both FireBird (database for store SSR data) and SSRLocator are needed for run the software. The installation manuals can be viewed at Farebird: http://cgfufpel.org/ssrlocator_farebird.htm . SSRLocator: http://cgfufpel.org/ssrlocator_install.htm. Download manuals at - Install FareBird DataBase - (pdf) - Install SSRLocator - (pdf) The user manual can be viewed at http://cgfufpel.org/ssrlocator_guia.htm.

SSR Discovery Using SSRLocator Install SSRLocator in C: as showing C:\SSRLocatorI Copy your data file with fasta format (.fasta) into the SSRLocatorI folder such as “cowpea_EST_1_0693.fasta” Open SSRLocatorI.exe Format file to SSRLocator Standard in the “Create File” button. Save a new file called “cowpea_EST_1_0693format.fasta” And more ……. Linked

SSRLocator - Output The SSR motif (AT) creates various repeats from 12 to 20 among the five cowpea samples (below Loci in the Table). Primer pairs are designed and expected PCR size are estimated ranged 211 to 381 bp. The polymorphism can be used as marker – SSR marker ! Contig Loci Start_SSR1 End_SSR1 FG938745_UCRVU09_UCR_707 (AT)20 239 278 FG908248_UCRVU08_CCNS5607_IT97K-461-4 (AT)13 204 229 FG875445_UCRVU07_CCNP10713_UCR_779 (AT)12 205 228 FG850994_UCRVU05_CCNN17188_IT84S-2049 (AT)19 200 237 FG815463_UCRVU04_CCNI2988_524B (AT)15 216 245 Contig Forward TM Reverse Product Size FG938745 AACAGCTTAGAGCGTGAAAG 55.1 TTTCGATGTGTGAGAAATGA 381 FG908248 CAGCTGTTAAACCACACAAA 54.9 213 FG875445 211 FG850994 224 FG815463 216

SSR Discovery Using SSRLocator Online Linked http://www.microsatellite.org/ssr.php Sequence data

Molecular Plant Breeding Fall 2016 - HORT6033 Molecular Plant Breeding Homework Download cowpea ESTs, run SSRLocator, and find SSRs. 2. Read SSR locator manual and SSR articles.

Homework 1 for week 1

Homework 1 for week 1 FALL 2016 HORT6033 Genetic Techniques in Plant Breeding (Molecular Plant Breeding) Homework 1 – week one (8/22 to 8/25/2016) Read the course syllabus at http://comp.uark.edu/~ashi/MB/HORT6033_syllabus.pdf Read the class presentations (download from http://comp.uark.edu/~ashi/MB/molecularBreeding_lesson.html)! Install SSRLocator! Please read the guide and manuals! Please check more info at the course web page at http://comp.uark.edu/~ashi/MB/SSRLocator.html! Examples will be found at our web site: Example 1: http://comp.uark.edu/~ashi/MB/example/cowpea_EST_1_0693.fasta Example 2 : http://comp.uark.edu/~ashi/MB/example/cowpea_SSR_SNP_geneticMap_marker.fasta For example 1 EST data, please run it for SSR discovery and primer design using BatchPrimer3 at http://batchprimer3.bioinformatics.ucdavis.edu/cgi-bin/batchprimer3/batchprimer3.cgi ! Please do: copy example 1 data and paste them to the Textbox in the tool interface. Click “Pick Primers” button! That’s it and you will find the SSRs and the SSR primer pairs! Run example 1 and 2 in SSRLocator Extra: Please read the article: Maia et al. 2008. Int J Plant Genomics. 2008:412696) at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2486402/ Wei et al 2011. Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers. BMC Genomics 2011, 12:451 (http://www.biomedcentral.com/content/pdf/1471-2164-12-451.pdf) Run Example 2 using SSRLocator Download all cowpea (Vigna unguiculata) ESTs from GenBank (we will discuss how to download million sequences from GenBank and save them to a local file.) Download and install BioEdit at http://www.mbio.ncsu.edu/bioedit/bioedit.html Download and install MEGA 6 at http://www.megasoftware.net/megacc.php Run example 1 in BioEdit and MEGA 6 Run all cowpea EST data in SSRLocator! Homework due: Right now, email homework to me at ashi@uark.edu anytime! Homework 1 should be due Sunday night (August 29). Each student should hand on the results and the summary of SSR discovery and also the primers (Monday class). Computer software and tool imitations, running, and exercise are counted as credit. Please have a list for all tools which you install, and you can run examples on it. The list should be emailed to me before the final exam. We will give you a test whether you can use the software or tools. The course requires you can run >= 10 tools. You can gain 5% for running more tools. Please also write out what articles you read during the semester and a simple summary for each article which you have read should be hang on.