A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA> These "sentences" are called genes.

Genes tell the cell to make other molecules called proteins Proteins are required for the structure, function, and regulation of the body's cells, tissues, and organs. .

Autosome = the name of the chromosomes in each cell that are not sex chromosomes The longest of the autosomes is referred to as chromosome 1, the next largest as chromosome 2, and so on, down to the smallest autosomes, chromosomes 21 and 22. The 46 chromosomes humans have contain approximately 35,000 genes We have approximately three billion base pairs (6 billion bases total) of DNA in most of our cells.

Meiosis The next series of 4 slides is taken from the site: http://www.micro.utexas.edu/courses/levin/bio304/genetics/celldiv.html The images are drawings and then actual pictures of the stages of meiosis during pollen formation in the flower of a lily.

                                                               

Monogenetic Diseases Scientists currently believe that single gene mutations cause approx. 6,000 inherited diseases. Called single gene or monogenetic diseases because a change in only one gene causes the disease Many lung and blood disorders, such as cystic fibrosis, sickle cell anemia, and hemophilia are monogenetic diseases. .

Complex Diseases Inheritance of major common diseases are not as simple Heart disease, diabetes, Alzheimer disease, psychiatric disorders, and osteoarthritis. Result from a combination of the effects of the environment and a number of susceptibility genes.

http://genetics.gsk.com/chromosomes.htm#topofpage Cell division video http://genetics.gsk.com/overview.htm#mutations DNA and genes video http://www.accessexcellence.org/RC/VL/GG/meiosis.html Site used for crossing over image and 2nd meiosis image http://www.psc.edu/~deerfiel/Protein-SciVis.html Protein image on slide 16