Tuesday, the 10th of September, 2013 Traitement de Séquences Brutes NGS Nettoyage, alignement, polymorphisme François Sabot Tuesday, the 10th of September, 2013 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 BUT du TD: 1- Galaxy vs Ligne de Commande 2- Comprendre un fichier FASTQ 3- Nettoyer des données Illumina/FASTQ 4- Comprendre un assemblage 5- Effectuer un mapping de séquences Illumina sur une Référence 6- Nettoyer un fichier SAM multiple François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Serveur IRD: http://bioinfo-master.ird.fr:8080/ 1- Galaxy Serveur IRD: http://bioinfo-master.ird.fr:8080/ Serveur principal: http://main.g2.bx.psu.edu/ François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 OUTILS DONNÉES François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 WEB SERVICE - système en “Click'n'Play” - transparent pour l'utilisateur François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 WEB SERVICE - système en “Click'n'Play” - transparent pour l'utilisateur MODULAIRE - briques de base nombreuses - ajout de briques personalisables François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 WEB SERVICE - système en “Click'n'Play” - transparent pour l'utilisateur MODULAIRE - briques de base nombreuses - ajout de briques personalisables MULTIPLE - basé sur serveur web (Apache...) - sur machine unique, cluster... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 WEB SERVICE - système en “Click'n'Play” - transparent pour l'utilisateur MODULAIRE - briques de base nombreuses - ajout de briques personalisables MULTIPLE - basé sur serveur web (Apache...) - sur machine unique, cluster... MAIS - Appui simple - Beaucoup moins puissant que terminal - Seulement pour analyse en routine - Seulement pour données limitées François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 CONNEXION POUR LE TD: http://bioinfo-master.ird.fr:8080/ François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Se Connecter... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Ajouter des données... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Importer des données depuis des bibliothèques de Galaxy François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Importer des données depuis des bibliothèques de Galaxy François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Création de WorkFlow pour analyses automatisées François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Fichier FASTQ → Fichier TEXTE Tuesday, the 18th of October, 2012 STRUCTURE: @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb @HWUSI-EAS454_0006:1:37:16314:3410#CTTGTA AGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGTGGTGGCCG `bTbbccccceeeeeceeeecccYeedded`ceec]dddde^a`deeeec\`dddcbaadadYd`]]Jc_^bc^^\ François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 NOM DE LA SEQUENCE @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 SEQUENCE IUPAC @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb QUALITÉ ASCII François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb f → Qualité de 38 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 WHAT IS QUALITY ? Quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
FASTQC: contrôle de la qualité Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
FASTQC: contrôle de la qualité Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Pourquoi nettoyer ? Enlever les adaptateurs/primers restants et les séquences de mauvaise qualité → CutAdapt François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Sequences from Solexa_adapters, one per one François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Vos données sont prêtes a l'emploi... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Séparation des séquences par individus d'origine RC1, RC2... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Séparation des séquences par individus d'origine RC1, RC2... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Séparation des séquences par individus d'origine RC1, RC2... François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Séparation des séquences par individus d'origine RC1, RC2... Utilisation d'expression rationelle via Galaxy: → RS|RC[13456789] & remove reads => conserve RC2 → RS|RC[23456789]|RC1_ & remove reads => conserve RC10 → RS|RC[23456789]|RC10 & remove reads => conserve RC1 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Mapping: Positionner les lectures 'pair-end' sur une référence 1- Calcul des positions de chaque lecture François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Mapping: Positionner les lectures 'pair-end' sur une référence 1- Calcul des positions de chaque lecture 2- Mise en relation des positions de chaque membre de la paire François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Mapping: Positionner les lectures 'pair-end' sur une référence 1- Calcul des positions de chaque lecture 2- Mise en relation des positions de chaque membre de la paire 3- Sélection de la position la plus probable respectant les conditions François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Mapping: Positionner les lectures 'pair-end' sur une référence 1- Calcul des positions de chaque lecture 2- Mise en relation des positions de chaque membre de la paire 3- Sélection de la position la plus probable respectant les conditions 4- Édition d'un fichier de sortie SAM François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Reference From History: Shared data/Formation/PreProcess/ref.fasta Library: Paired-end FASTQ files: Depuis votre historique BWA setting to use: Commonly Used Décocher “Suppress the header in the output SAM file” Cliquer François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Sortie en fichier SAM (Sequence Alignment/Map) François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Tri du fichier SAM par coordonnées NE MARCHE PAS François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 Workflow: comment éviter de tout refaire à la main François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot
Tuesday, the 18th of October, 2012 François Sabot Tuesday, the 18th of October, 2012 Alexis Dereeper, François Sabot