Institute of Social and Preventive Medicine, University of Lausanne Revolution in genetics: what should NCD programme managers know about it? (focus on LMIC) Murielle Bochud, MD, PhD Institute of Social and Preventive Medicine, University of Lausanne

Angelina Jolie's preventive double mastectomy Angelina Jolie has a positive family history of breast cancer. A genetic screening test determined that Jolie was at increased risk of developing breast cancer (BRCA1). Angelina Jolie underwent a preventive double mastectomy.  Mutations in BRCA1 and BRCA2 account for small proportion of all breast cancer cases (1-2%).

Katsanis Nat Rev Genet 2013

Technological advances have boosted our ability to make genetic testings http://www.ncbi.nlm.nih.gov/projects/GeneTests/static/whatsnew/labdirgrowth.shtml

Human genome in numbers 46 Chromo somes Human genome in numbers 6 billions DNA letters A C 22’000 GENES G T Cost to sequence $10’000

Organization of DNA in human cells

Each cell with a nucleus contains our genome composed of DNA Human being Organ Cell Nucleus Chromosome DNA

SNPs are the most common genetic markers ATTCCGAGTTTACCGCGTA Maternal chromosome ATTCCGAGTTTATCGCGTA Paternal chromosome > 20 millions SNPs identifed in the human genome SNP (single nucleotide polymorphism)

Type, frequency and novelty of genetic variants The 1000 genomes project; Nature 2010; 467: 1061

A locus is a specific location on the genome that can carry multiple alleles ACCGTTACGTTA ACCGTCACGTTA Locus 1 Locus 1 An allele is the form that the DNA can take at a particular locus. A subject can carry carry either a T or a C allele at locus 1.

The allele is the unit of transmission from parents to their offspring Parents transmit ALLELES (AND NOT GENOTYPES) to their offspring AC CC father mother Family tree Possible genotypes: AA, AC, CC Allele A is paternally transmitted Allele C is maternally transmitted

A gene is composed of coding (exons) and non-coding (introns) parts DNA sequence: AATGCTGACAGTCCGATATGCTCGATGGATCTCCAGAATGTGCGA exon 1 exon 2 exon 3 intron 1 intron 2 A gene is the unit of heredity Human genetics is the study of human gene variation

Genes code for proteins exon 1 exon 2 exon 3 exon 4 intron 1 intron 2 intron 3 contiguous genomic sequence segmented genomic sequence mRNA PROTEINS

 a few rare mutations Several common mutations strong effect sizes POPULATION INDIVIDUALS / FAMILIES Polygenic diseases (Common complex diseases) Monogenic diseases (Mendelian diseases)  a few rare mutations strong effect sizes Several common mutations weak to moderate effect sizes SNPs genetic markers promoter coding region gDNA Aminoacid change in highly conserved regions that are functionally important functional SNPs Courtesy of PY Bochud

Published GWA Reports, 2005 – 6/2012 1350 Total Number of Publications Calendar Quarter Through 6/30/12 postings

Published Genome-Wide Associations through 12/2012 Published GWA at p≤5X10-8 for 17 trait categories NHGRI GWA Catalog www.genome.gov/GWAStudies www.ebi.ac.uk/fgpt/gwas/

Common alleles usually have small effects… Manolio et al, Nature 2009; 461(7265): 747–753

We are probably only seeing the tip of the iceberg 1-5% via one-marker-at-a-time analysis: common variants with small effects Other common variants with Small effect Rare variants with large effects Gene-gene and gene-environment interactions

Manhattan plot for renal function CKDGen Consortium Manhattan plot for renal function 29 known or novel GFR loci Pattaro et al, PLoS Genet, 2012

Genetic risk score does not predict incident chronic kidney disease Framingham Heart Study Outcome: incident stage 3 CKD (eGFR <60 mL/min/1.73 m(2)) at follow-up. O'Seaghdha et al, Am J Kidney Dis. 2012

For type 2 diabetes, genetic information does not improve risk prediction when compared with classical risk factors such as age, sex, family history, BMI, etc. Talmud et al, BMJ 2010

Cumulative effect of obesity variants: association of obesity genetic risk score with BMI Vimaleswaran & Loos Exp Rev Mol Med 2010, 12:e7

Narrowing the valley of death… Research findings Clinically useful applications

The PharmGKB Knowledge Pyramid                                                              The PharmGKB Knowledge Pyramid The PharmGKB (pharmacogenomics knowledge) resource collects, curates and disseminates knowledge about the impact of human genetic variation on drug responses: dosing guidelines and drug label potentially clinically actionable gene-drug associations genotype-phenotype relationships. Clinical implementation Clinical interpretation Knowledge annotation, Aggregation & interpretation Knowledge extraction Primary pharmacogenomics literature Variant Gene Type Level of evidence Drugs Phenotype/ disease rs1800584 TPMT Toxicity/ADR 1A mercaptopurine Some cancers rs4986893 CYP2C19 Efficacy,Toxicity/ADR clopidogrel Acute coronary syndrome, CAD rs776746 CYP3A5 toxicity/ADR 2A tacrolimus Kidney Transplantation www.pharmgkb.org

Genetic variants for hyperuricaemia or gout. 2008–2011 Reginato et al, Nat Rev Rheumatol 2012

Major contribution of GWAS findings to urate (patho)physiology Reginato et al, Nat Rev Rheumatol 2012

Major contribution of GWAS findings to gout pathophysiology Reginato et al, Nat Rev Rheumatol 2012

Ethical considerations for genetic testing Secondary findings in whole exome and whole genome sequencing data will identify several mutations that are disease-causing variants. No consensus on whether or how to share this information with patients. Need to confirm results by a clinical laboratory before returning to a patient. Exploration of informed consent models allowing patients to elect what information to disclose. The duty to inform patients of predictable risks could be influenced by the legal pressure and threat of malpractice. Ethical challenge for genetic testing in children to decide whether to test or to disclose results for adult-onset genetic conditions. Privacy and discrimination Country-specific legislations in Europe aiming at protecting for health and life insurance discrimination on the basis of genetics. In the US: GINA (Genetic Information Non-discrimination Act). It is not clear whether discrimination based on genetic testing will become an issue worldwide. Until this has been clarified, the question is how to protect currently generated WES and WGS data. Katsanis Nat Rev Genet 2013

Conclusions Rapid technological advances have boosted our ability to screen the human genome, raising important and new ethical challenges. Rapidly evolving understanding of the structure and function of the human genome. Massive number of new genetic variants-disease associations (useful mainly to advance knowledge on disease biology). These findings will likely to lead to reclassification of many diseases. Clinical utility of genetic testing limited for common complex diseases. Aim: more personalized treatment and prevention

Thank you.

Ethnic differences in breast cancer incidence Hines – 2010 - Cancer

Breast cancer One in nine women will develop breast cancer in their lifetime. Mutations in BRCA1 and BRCA2 account for small proportion of all breast cancer cases (1-2%). Much higher proportion of cases with a strong family history of breast or ovarian cancer. Prophylactic mastectomy is the most effective strategy to reduce the risk of breast cancer in women at high-risk, but there is no clear evidence for mortality reduction after prophylactic mastectomy.