Whole Genome Sequencing for Epidemiologists – A Brief Introduction

Slides:

Advertisements

Similar presentations

Genomes and Proteomes genome: complete set of genetic information in organism gene sequence contains recipe for making proteins (genotype) proteome: complete.

Advertisements

An Introduction to “Bioinformatics to Predict Bacterial Phenotypes” Jerry H. Kavouras, Ph.D. Lewis University Romeoville, IL.

Genetic Engineering. Vocabulary Gene – sequence of DNA that codes for a trait (protein). Genome – an organism’s complete genetic information. Transgenic.

MICROBIAL TAXONOMY Phenotypic Analysis Genotypic Analysis.

1 Don L. Zink, Ph.D. Center for Food Safety and Applied Nutrition U.S. Food & Drug Administration College Park, MD The Challenge of Emerging Foodborne.

WHO Global Salm-Surv: A Global Salmonella Surveillance Network World Health Organization, Geneva Centers for Disease Control and Prevention, Atlanta Danish.

Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.

Molecular Biology of Genes Chapters DNA Technology (not in your book)

Terry Kotrla, MS, MT(ASCP)

Molecular Surveillance of Foodborne Infections Peter Gerner-Smidt, MD, PhD Chief of PulseNet USA CDC

Lee H. Harrison, MD Associate Professor

Molecular Identification Methods Confirmation of identity for commonly used laboratory strains should ideally be done at the level of genotypic analysis’…...

DNA Technology and Genomics Chapter 20 A. P. Biology Mr. Knowles Liberty Senior High School.

Single Nucleotide Polymorphisms Mrs. Stewart Medical Interventions Central Magnet School.

Gene expression and DNA microarrays Old methods. New methods based on genome sequence. –DNA Microarrays Reading assignment - handout –Chapter ,

Chapter 5 Microbial Genetics. Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated.

Chapter 13 GENE TECHNOLOGY. Section 1: DNA TECHNOLOGY-Tools of DNA Positive ID at a crime scene Improvement of food crops Human predisposition for disease.

DNA Profiling in Forensic Science. Introduction DNA Profiling is the analysis of DNA samples to determine if they came from the same individual. Since.

Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.

© 2012 Pearson Education, Inc. Lecture by Edward J. Zalisko PowerPoint Lectures for Campbell Biology: Concepts & Connections, Seventh Edition Reece, Taylor,

Used for detection of genetic diseases, forensics, paternity, evolutionary links Based on the characteristics of mammalian DNA Eukaryotic genome 1000x.

 DNA Fingerprinting. Variation in Human DNA  Of 3 billion nucleotides in human DNA more than 99% are identical  Of 1% that are different  significant.

DNA Fingerprinting Project Lead the Way Human Body Systems.

Forensic Science: Fundamentals & Investigations, Chapter 7 1 Introduction and History of Biological Evidence in Forensics DNA fingerprinting or DNA profiling,

Evaluation of Status of Pulsed Field Gel Electrophoresis as a Molecular Typing Technique in Indian S. Typhi Strains Meenakshi, Randhawa V S, Rao B, Dutta.

Salmonella enterica Bredeney: Third commonest cause of human infection in Ireland in 1999 C. A. O’ Hare, M. Cormican. G. Corbett-Feeney, S. Fanning and.

DNA Fingerprinting. Introduction to DNA Fingerprinting Technicians in forensic labs are often asked to do DNA profiling or “fingerprinting” Restriction.

Review Unit 1.3 Identity: Molecules and Cells. 1. What is the structure and the function of DNA? DNA Deoxyribonucleic acid – composed of nucleotides made.

3.5 GENETIC MODIFICATION AND BIOTECHNOLOGY. UNDERSTANDING Gel electrophoresis is used to separate proteins of fragments of DNA according to size PCR can.

2. Centers for Disease Control and Prevention (CDC), Atlanta, GA, USA

Steffany Cavallo, MPH (Tennessee) Carlota Medus, PhD, MPH (Minnesota)

Martin Wiedmann Cornell University

COLLEGE OF VETERINARY MEDICINE

Group Name Ecoli1 Group member name Thomas Kinga Tim Malin Jenny.

Phenotypic and genotypic typing of Salmonella enterica serovar Enteritidis isolates from poultry farms in Tunisia Guedda Intissar1, Abbassi Mohamed Salah1,

Figure 1 Principle coordinates analysis plot for 127 Escherichia coli isolates from the SENTRY and Meropenem Yearly Susceptibility Test Information Collection.

Tracking a hospital outbreak of KPC-producing ST11 Klebsiella pneumoniae with whole genome sequencing Y. Jiang, Z. Wei, Y. Wang, X. Hua, Y. Feng, Y.

Microbial Taxonomy and the Evolution of Diversity

Whole genome sequencing: New methods for traceback investigations

REDUCED RATES OF VANCOMYCIN RESISTANT ENTEROCOCCI (VRE) COLONIZATION

Future Directions Unknowns:

Relationship between Genotype and Phenotype

Single Nucleotide Polymorphisms

Biology, 9th ed,Sylvia Mader

Scientists use several techniques to manipulate DNA.

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Recombinant DNA Techniques chapter 18 begins page 510

Genomes and Their Evolution

With Genetic Analyzers from Applied Biosystems

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Sporadic occurrence of CMY-2-producing multidrug-resistant Escherichia coli of ST- complexes 38 and 448, and ST131 in Norway U. Naseer, B. Haldorsen,

Introduction to Bioinformatics II

Dice (Tol 1.0%–1.0%) (H>0.0 % S>0.0%)

Tracking a hospital outbreak of KPC-producing ST11 Klebsiella pneumoniae with whole genome sequencing Y. Jiang, Z. Wei, Y. Wang, X. Hua, Y. Feng, Y.

DNA Fingerprinting.

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Laboratory Investigation

Ciprofloxacin-resistant, CTX-M-15-producing Escherichia coli ST131 clone in extraintestinal infections in Italy M. Cerquetti, M. Giufrè, A. García-Fernández,

Biology, 9th ed,Sylvia Mader

Close genetic relationship between Salmonella enterica serovar Enteritidis isolated from patients with diarrhoea and poultry in the Republic of Korea

J. Price, N. Claire Gordon, D. Crook, M. Llewelyn, J. Paul

Biotechnology: Restriction Enzyme Analysis of DNA

Restriction Fragment Length Polymorphism (RFLP)

9-3 DNA Typing with Tandem Repeats

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

13.2 – Manipulating DNA.

Relationship between Genotype and Phenotype

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Combination of pulsed-field gel electrophoresis (PFGE) and single-enzyme amplified fragment length polymorphism (SAFLP) for differentiation of multiresistant.

Presentation transcript:

Whole Genome Sequencing for Epidemiologists – A Brief Introduction Joel R Sevinsky, PhD

Objectives Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing (WGS) Example of WGS for outbreak investigation Questions

Microbial Genomes Genome size varies from 4.56 to 5.70 Mb How big is 5 Mb???

Harry Potter Story Long story, some big books! 1,084,440 words in all seven books Average word length ~5 letters ~5,422,200 letters total in box set E.coli genomes range from 4.56 to 5.70 Mb A single E. coli genome @ 1 box set Single human genome @ 1,000 box sets!!!

PFGE (Pulsed Field Gel Electrophoresis) What do these bands really mean???

PFGE (Pulsed Field Gel Electrophoresis) 5 Mb 5Mb 1Mb 0.5Mb 1 site 2 sites 3 sites 4 sites Restriction enzyme site Genome size in Mb

Harry Potter Story Specific word = enzyme restriction site Word frequency determines banding pattern. Different words represent different enzymes. What does PFGE really tell you then? Table 1 Book Frequency Voldemort (n) Sorcerer’s Stone 31 Chamber of Secrets 20 Prisoner of Azkaban 37 Table 2 Book Frequency Broomstick (n) Spell (n) Wand (n) Wizard (n) Sorcerer’s Stone 27 14 62 41 Chamber of Secrets 12 6 107 44 Prisoner of Azkaban 20 114 39

Isolate Identification Techniques Protein Serotyping PFGE Pulsed Field Gel Electrophoresis Total gDNA fragments 16S rRNA Ribosomal RNA Sequencing 1 gene MLST Multi Locus Sequence Typing 7 genes wgMLST Whole Genome Multi Locus Sequence Typing Thousands of reference genes plus pan genome wgSNP or hqSNP Whole Genome Single Nucleotide Polymorphism Typing Total gDNA DNA Sequencing Information  WGS

Whole Genome Sequencing 40 box sets

Whole Genome Sequencing ATGCGTGATCTAGTAGTCTAGGAGCTGACCGATTA

WGS for Outbreak Investigations Salmonella enterica serovar Enteritidis JEGX01.004 JEGX01.002

WGS for Outbreak Investigations JEGX01.002 JEGX01.004

WGS for Outbreak Investigations A = suspect isolate, same time/PFGE B = same patient over 5 weeks

WGS for Outbreak Investigations C = suspect isolate for outbreak 5 D = environmental isolate, egg farm swab

WGS Beyond Outbreak Investigations “…comparison of these 61 genomes sequences revealed that neither the 16S gene, nor the gene fragments usually used for MLST, provides biologically meaningful information on the relatedness of the sequenced isolates. The best way to analyze this is by taking into account all the genomic content, rather than looking at one or a few individual genes.”

WGS Beyond Outbreak Investigations Genome size varies from 4.56 to 5.70 Mb This size variation demonstrates a genomic difference of up to 1 Mb between isolates. 1 Mb = ~1,000 genes

WGS Beyond Outbreak Investigations

Reference Characterization by WGS “One Shot” Characterization of STEC ANI SerotypeFinder VirulenceFinder 7-gene MLST ResFinder Phylogenetic ID GENUS/SPECIES: Escherichia coli SEROTYPE: O104:H4 PATHOTYPE: Shiga toxin producing and Enteroaggregative E. coli (STEC & EAEC) VIRULENCE PROFILE: stx2a, aggR, aggA, sigA, sepA, pic, aatA, aaiC, aap SEQUENCE TYPE: ST678 ANTIMICROBIAL RESISTANCE GENES: blaTEM-1, blaCTX-M-15, strAB, sul2, tet(A)A, dfrA7 wgMLST CODE: 102:45.26.35.3

Summary of Potential WGS Applications Outbreak investigation Sporadic vs outbreak Not just cluster but phylogenetic relationships Microbial Source Tracking (MST) Microbial Surveillance Food Environment Animals, soil, food prep areas, hospitals, etc Antibiotic resistance monitoring Genotype predicts phenotype Mobile vs integrated Virulence gene monitoring What else???

Questions?