From Gene To Protein DNA -> RNA -> Protein Gene transcription is done by RNA Polymerase RNA translation is done by ribosomes according to the genetic code. Gene structure – promoters, introns, exons. RNA structure – Poly A Tails, 5’ Caps, splicing. Provides the molecular basis for mutations.

Where does transcription occur? Prokaryotes Eukaryotes

Transcription RNA Polymerase synthesizes mRNA that is complementary to the gene DNA sequence. mRNA sequences are hundreds to thousands of bases long. Primers are 5-10 bases, no genetic information.

Difference of DNA to RNA Sugar and Thymine vs Uracil

Base pair rules are followed to transcribe portion of DNA (gene) into mRNA. The genetic code is used to specify the order of the 20 kinds of amino acids.

Prokaryote RNA Polymerase binds to promoter

Promoter DNA sequence, part of it is A,T rich, (TATA Box) Binds to RNA Polymerase

RNA Polymerase in E. Coli (Prokaryote) Complex set of polypeptides, not a single protein (Proteins) 2 alpha proteins bind to regulatory site,determines if transcription will happen. A Beta and beta’ catalyze RNA synthesis. Synthesizes RNA in the 5’ to 3’ direction. RNA is complementary to the DNA template strand, base pair rules followed. (A=U, G=C) RNA is antiparallel to the DNA strand so that Hydrogen bonds can form.

Hydrogen bonds in DNA Due to bond angles and positions the two strands must run anti-parallel.

Transcription Broke into 3 phases Initiation: when RNA polymerase is attached to promoter. Elongation: Adding bases. Termination: When RNA polymerase detaches from DNA strand.

Prokaryote RNA polymerase separates the two strands of DNA and initiates transcription 5’ UTR 3’ UTR

Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase Figure 17.7-1 Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase Figure 17.7 The stages of transcription: initiation, elongation, and termination.

Nontemplate strand of DNA 5 3 3 5 Template strand of DNA Figure 17.7-2 Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase 1 Initiation Nontemplate strand of DNA 5 3 3 5 Template strand of DNA RNA transcript Unwound DNA Figure 17.7 The stages of transcription: initiation, elongation, and termination.

Nontemplate strand of DNA 5 3 3 5 Template strand of DNA Figure 17.7-3 Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase 1 Initiation Nontemplate strand of DNA 5 3 3 5 Template strand of DNA RNA transcript Unwound DNA 2 Elongation Rewound DNA 5 3 3 3 5 5 Figure 17.7 The stages of transcription: initiation, elongation, and termination. RNA transcript

Nontemplate strand of DNA 5 3 3 5 Template strand of DNA Figure 17.7-4 Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase 1 Initiation Nontemplate strand of DNA 5 3 3 5 Template strand of DNA RNA transcript Unwound DNA 2 Elongation Rewound DNA 5 3 3 3 5 5 Figure 17.7 The stages of transcription: initiation, elongation, and termination. RNA transcript 3 Termination 5 3 3 5 5 3 Completed RNA transcript Direction of transcription (“downstream”)

Several transcription factors bind to DNA Transcription factors Figure 17.8 1 A eukaryotic promoter Promoter Nontemplate strand DNA 5 T A T A A A A 3 3 A T A T T T T 5 TATA box Start point Template strand 2 Several transcription factors bind to DNA Transcription factors 5 3 3 5 3 Transcription initiation complex forms RNA polymerase II Figure 17.8 The initiation of transcription at a eukaryotic promoter. Transcription factors 5 3 3 3 5 5 RNA transcript Transcription initiation complex

Nontemplate strand of DNA Figure 17.9 Nontemplate strand of DNA RNA nucleotides RNA polymerase T C C A A A 3 T 5 U C T 3 end T G U A G A C A U C C A C C A 5 A 3 T Figure 17.9 Transcription elongation. A G G T T 5 Direction of transcription Template strand of DNA Newly made RNA

Transcription Video (24:28)

Question 1 How can you identify which end is 5’ and 3’ of the newly synthesized mRNA strand?

Translation Ribosomes read the mRNA sequence and synthesize a polypeptide. The order of the amino acid is determined by the mRNA sequence. Broken into 3 phases: Initiation Elongation Termination

Translation Overview

tRNA Stems have hydrogen bonds, complimentary bases. Loops have no hydrogen bonds, no base pairs. As a result of that, tRNA has very distinct shapes.

Aminoacyl-tRNA synthetase (enzyme) Figure 17.16-2 Aminoacyl-tRNA synthetase (enzyme) Amino acid P Adenosine P P P Adenosine P P i ATP P i P i Figure 17.16 An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA.

Aminoacyl-tRNA synthetase Figure 17.16-3 Aminoacyl-tRNA synthetase (enzyme) Amino acid P Adenosine P P P Adenosine P P i Aminoacyl-tRNA synthetase ATP P i P tRNA i tRNA Amino acid Figure 17.16 An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA. P Adenosine AMP Computer model

Aminoacyl-tRNA synthetase Figure 17.16-4 Aminoacyl-tRNA synthetase (enzyme) Amino acid P Adenosine P P P Adenosine P P i Aminoacyl-tRNA synthetase ATP P i P tRNA i tRNA Amino acid Figure 17.16 An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA. P Adenosine AMP Computer model Aminoacyl tRNA (“charged tRNA”)

Ribosome Consists of two subunits. Contains three sites Large subunit (Top) Small subunit (Bottom) Contains three sites E site (Exit site) P site (Peptidyl tRNA Binding Site) A site (Aminoacyl tRNA Binding Site)

P site (Peptidyl-tRNA binding site) Exit tunnel Figure 17.17b P site (Peptidyl-tRNA binding site) Exit tunnel A site (Aminoacyl- tRNA binding site) E site (Exit site) E P A Large subunit Figure 17.17 The anatomy of a functioning ribosome. mRNA binding site Small subunit (b) Schematic model showing binding sites

Shine-Delgarno Sequence Approximately 6-8 bases upstream of the AUG codon is another conserved sequence, found above all start codons, called Shine-Delgarno sequence. That sequence is AGGAGG. Small subunit of ribosome has a complementary sequence, UCCUCC, that searches and finds that complementary sequence, and that is how it identifies where to begin translation.

What is the importance of the Shine-Delgarno sequence?

Elongation Cycle of Translation

Amino end of polypeptide Figure 17.19-1 Amino end of polypeptide E 3 mRNA P site A site 5 Figure 17.19 The elongation cycle of translation.

Amino end of polypeptide Figure 17.19-2 Amino end of polypeptide E 3 mRNA P site A site 5 GTP GDP  P i E P A Figure 17.19 The elongation cycle of translation.

Amino end of polypeptide Figure 17.19-3 Amino end of polypeptide E 3 mRNA P site A site 5 GTP GDP  P i E P A Figure 17.19 The elongation cycle of translation. E P A

Amino end of polypeptide Figure 17.19-4 Amino end of polypeptide E 3 mRNA Ribosome ready for next aminoacyl tRNA P site A site 5 GTP GDP  P i E E P A P A Figure 17.19 The elongation cycle of translation. GDP  P i GTP E P A

Termination of Translation Termination occurs when a stop codon in the mRNA reaches the A site of the ribosome The A site accepts a protein called a release factor The release factor causes the addition of a water molecule instead of an amino acid This reaction releases the polypeptide, and the translation assembly then comes apart Animation: Translation © 2011 Pearson Education, Inc. 40

Release factor 3 5 Stop codon (UAG, UAA, or UGA) Figure 17.20-1 Figure 17.20 The termination of translation. (UAG, UAA, or UGA)

Release factor Free polypeptide 3 3 5 5 Stop codon Figure 17.20-2 Release factor Free polypeptide 3 3 5 5 2 GTP Stop codon 2 GDP  2 P i Figure 17.20 The termination of translation. (UAG, UAA, or UGA)

Release factor Free polypeptide 5 3 3 3 5 5 Stop codon Figure 17.20-3 Release factor Free polypeptide 5 3 3 3 5 5 2 GTP Stop codon 2 GDP  2 P i Figure 17.20 The termination of translation. (UAG, UAA, or UGA)

Translation Video (34:05)

Translation Termination

Gene Structure Genes have a promoter, a coding region and a termination region. Eukaryote genes have exon and intron structures. Exon- what is translated Intron- What will be cut out.

RNA Splicing in Eukaryotes 5’ Cap and 3’ poly A tail are enzymatically added immediately to the primary transcript. Primary transcript is also called Heterogenous RNA, HnRNA. 5’ cap is a guanine attached to 3 phosphates. 3’ Poly A tail is ~ 150-200 bases added by polyadenylate polymerase. 5’ cap helps ribosome to identify 5’ end of strand.

Eukaryote genes are interupted

Definitions of Splicing components snRNA-small nuclear RNA, has specific base sequence. snRNP-small nuclear ribonucleo-protein complex. Each has own snRNA and about 7 different proteins. There are 5 different snRNP’s, each with its own distinct snRNA (U1, U2, U4, U5, or U6) Spliceosome-complex of all the snRNA’s and work together to mediate splicing.

Introns were discovered by comparing the sequences of genes (NDA) and their mRNA’s GACCCCCATCCATTGATGAGAGAAGGTCAGTTAAGCG CTGGGGGTAGGTAACTACTCTCTTCCAGTCAATTCGC HnRNA CUGGGGGUAGGUAAGUACUCUCUUCCAGUCAAUUCGG mRNA CUG-GGG-UCA-AUU-CGG Protein Leu-Gly-Ser-Ile-Arg

Splicing with snRNP’s

snRNP

Spliceosome Job is to hold everything together until everything is completed.

Alternative Splicing One gene is transcribed into HnRNA. HnRNA processed by alternative splicing to make multiple mRNA’s that are translated to make multiple proteins from one gene.