Searching for the Genes that Control Seed Development A Research Study in Arabidopsis thaliana Joanna Naymark HC70A Lab Spring, 2005

Overview of Project What we want to know about a gene: What is the structure? Where is it active in the Arabidopsis plant? Are there SALK knockouts? Do multiple lines need to be analyzed? What are the Phenotypic Effects in Arabidopsis? Genes Studied in this Project Gene One: At5g10510 Gene Two: At5g65510

What Proteins Do At5g10510 and At5g65510 Encode? Ovule development proteins, similar to Aintegumenta Responsible for development of Integuments (Seed Coat)

How Does This Protein Function? Codons encoding amino acids which form the GCC- binding portion of the protein. At5g10510.1 and At5g65510.1 are AP2 Transcription Factors

At5g10510 What is the Structure? 7 Exons 6 Introns 2 SALK insertions of interest

At5g10510 Where is it Active? Expected activity in three stages of Seed No activity expected in Leaf, Root, Stem, or Flower RT-PCR amplifies cDNA Results show slightly higher gene activity in Silique than Leaf (bright- ness of bands), but difference not as drastic as expected (492 bp expected)

At5g10510 What Does the Promoter Look Like? Expected Size: ~ 3,430 bp (Accounting For Length of Primers) Actual Size: EcoRI digestion shows promoter isolated from plasmid with size ~3.5 kbp

At5g10510 Is This Insertion the Promoter of my Gene-of-Interest? Sequencing with SP6 and T7 Primers SP6: 2 base pair mutations T7: 2 base pair mutations, 2 base pair deletions SP6 Query: 120 gaaaacgcggtaaaataacacttcatctacctGaaggacggtagataatttctttagaaa 179 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 4646 gaaaacgcggtaaaataacacttcatctacctaaaggacggtagataatttctttagaaa 4705 Query: 480 ttcttcacaagccttaatattttaaTtacttttaattaaagttttcgatttgatctttta 539 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 5006 ttcttcacaagccttaatattttaactacttttaattaaagttttcgatttgatctttta 5065 T7 Query: 646 ttaaactataaaaagatacaaaagttgcagtagagagaga--gagaatgtgcatgtagag 703 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 7396 ttaaactataaaaagatacaaaagttgcagtagagagagagagagaatgtgcatgtagag 7337

At5g10510 What are the Genotypes of my Plants? Genotyping PCR using tDNA LBb1 and Gene-Specific Reverse Primer Genotyping by PCR using Gene-Specific Forward and Reverse and tDNA LBb1 Primers All Homozygous Wildtype Genotypes No tDNA Bands

At5g10510 Continuing to Search for tDNA Inserts Allele Two: SALK_021823 tDNA Insert

At5g10510 What are the Genotypes of the Plants with this new Salk Insertion? Genotyping PCR Reaction Using Gene-Specific Forward and Reverse Primers and tDNA LBb1 Primer Heterozygous Homozygous Mutant

At5g10510 What is the Exact Location of the SALK_021823 Insertion? Exact alignment of two sequences: Result of sequencing reaction using LBb1 primer in tDNA band of both heterozygous and homozygous mutant plants Chromosomal gene sequence

At5g10510 What’s the Difference? Expected location of tDNA insert: 3886 base pairs from start of gene Actual location of tDNA insert: 3830 base pairs from start of gene

At5g10510 What are the Phenotypic Effects of This Gene? Heterozygous Plant Homozygous Mutant Plant (with tape) Homozygous Wildtype Plant (above)

Wildtype Seeds (82) (83) (Magnification 20x)

Are there mutations in the embryos? Older Homozygous Mutant Young Homozygous Mutants (88) (84) Known Mutant (90) Titan (1)

Gene 2: At5g65510 What is the Structure? 6 Exons 5 Introns Salk Insert SALK_032039

At5g65510 Where is it Active? Expected activity in three stages of seed Not very active in the leaf, root, stem, flower RT-PCR reaction on reversely- transcribed mRNA of gene shows activity in Silique Low activity in Leaf, as expected

At5g65510 What Does the Promoter Look Like? Expected Size, According to Promoter Primers Actual Size of Promoter, According To EcoR1 Digestion ~ 2.3 kbp Size of Plasmid Vector ~3.5 kbp

At5g65510 Is this Insertion the Promoter? Sequencing with SP6 1 point mutation, 2 base pair additions Sequencing with T7 1 point mutation SP6 Query: 220 gtgagtaatcataatactataaatatgGaaatgtacgtttgggatcattaaattattcat 279 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 181 gtgagtaatcataatactataaatatgaaaatgtacgtttgggatcattaaattattcat 240 Query: 640 taaacaaaaaggcaacaacaagcccAaaaaactgtcaaaacttggggtataaaagggaaa 699 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 601 taaacaaaaaggcaacaacaagccc-aaaaactgtcaaaacttggggtataaaagggaaa 659 T7 Query: 44 gcagcagcagcCtctatctcagcttcttctttgaaagcttaaaccaaaacaaacaaacaa 103 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2314 gcagcagcagcttctatctcagcttcttctttgaaagcttaaaccaaaacaaacaaacaa 2255

At5g65510 What are the Genotypes of My Plants PCR Reaction Results, using Gene- Specific Fw and Rv Primers only Specific Fw and tDNA LBb1 Primers only Genotyping Results: All 16 Plants are Homozygous Wildtype. Expected size of ~3,100 bp No visible bands, no tDNA insertion

At5g65510 Are There Any Visible Phenotypic Effects? Since there were no successful tDNA insertions, no visible mutations exist Leaves and Meristem Siliques Flowers

Conclusions Although these two genes may have important roles in seed development, no phenotypic evidence Problem of gene masking? Lack of tDNA inserts posed a problem Future Experiments Better Knockouts (Quantity, Location) Double Mutants?