Mutation Notes: Chapter 11.

Slides:

Advertisements

Similar presentations

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Advertisements

Genes and mutations. What are genes? A molecular unit of heredity The name for stretches of DNA and RNA that code for a specific protein (which has a.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.

MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.

Mutations Chapter 12.4.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Review: DNA, Transcription & Translation

Gene Mutations Chapter 11.

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Section 11.3 Genetic Changes.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Mutations that happen during Transcription and Translation

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.

MUTATIONS Intro video

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Chromosomes/DNA Mutations. Chromosome Mutation Mutations are permanent gene or chromosome changes that will be passed on to offspring if they occur in.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Mutations. We all make mistakes. Sometimes cells make mistakes, too -- -like when they copy their DNA.

Section 11.3: Genetic Changes

Mutation Notes Chapter 12-4.

11.3 Mutations.

Chapter 14 GENETIC VARIATION.

Mermaid Syndrome Video.

Gene Mutations Chapter 11.

12- 4 Mutations.

Genetic Mutations.

Genetic Mutations.

Gene Mutations.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

Genetic Mutations.

Protein Synthesis.

Mutations LN #23 Ms. Garcia California Content Standard Genetics

Chapter 13: Genes & Chromosomes

To be successful today…

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

Mutations A mutation is any change in the DNA sequence.

Gene and Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

Mutations A mutation is any change in the DNA sequence.

Draw a conclusion from this graph for both the red and blue line

10th Grade Biology Mr. Walker

1) Base Mutations 2) Chromosomal Mutations

Genetic Mutations.

Mutation, Natural Selection, and Artificial Selection

I. Mutations A change in the genetic code

11.3 Section Objectives – page 296

DNA Mutations Types & their effects.

Presentation transcript:

Mutation Notes: Chapter 11

Mutations notes outline Types at gene level A. Point B. Frameshift which is worse? Types at chromosome level A. Deletion B. Insertion C. Inversion D. Translocation Causes A. Random/spontaneous B. Mutagen Results -, +, no effect

Mutation: Mistake or change in DNA sequence

Types of mutations at the gene level: Point: change in a SINGLE base pair in DNA Example: ACTAGGCAC to ACTAGTCAC Like: the dog bit the CAT to the dog bit the CAR Results in a change of one codon

The change in the DNA is minor but important

The effects of point mutations mRNA Normal Protein mRNA Point mutation Protein

Frameshift mutations A single base is added or deleted from DNA which shifts the reading of codons by one base. ex. ACTAGGCAC to ACTAGAC Like: The dog bit the cat to The dob itt hec at

The results of frameshift mutations can be HUGE since every codon after the mistake is affected!

Frameshift mutations Without mutation Deletion of U mRNA Protein

Point vs. Frameshift Mutations Which type of mutation is more serious? Frameshift mutation affects every amino acid after the mutation Point mutation affects only the amino acid at the mutation

Chromosomal Alterations Chromosomal mutations--Structural changes in chromosomes Are especially common in plants. 4 main types— Deletion, insertion, inversion, translocation

Types of chromosomal mutations: Deletion: part of a chromosome left out (usually deadly) A B C E F G H A B C D E F G H Deletion

Types of chromosomal mutations: Insertion: additions to a chromosome Usually from a sister chromatid

*Genes B and C were inserted into Insertion A B C D E F G H A B C B C D E F G H Insertion *Genes B and C were inserted into the chromosome*

Types of chromosomal mutations: Inversion: chromosome part breaks off and reattaches backwards A B C D E F G H A D C B E F G H Inversion

Types of chromosomal mutations: Translocation: chromosome part breaks off and adds to another chromosome Translocation

Causes of Mutations Spontaneous/Random mutations– Some mutations just happen, (ie. mistake during DNA replication, transcription, mitosis, meiosis). These lead to evolution. Mutagen-- Any agent that causes a change in DNA Include environmental factors like chemicals and radiation Lead to birth defects if sex cells affected and cancer if body cells affected

Mutations can be: Negative: cause a structural or functional problem Positive (very rare) ex. Can make the organism faster or stronger Have no effect = silent mutation

Sometimes chromosomes fail to separate properly and result in extra or fewer chromosomes: Down syndrome- extra chromosome # 21 Turner syndrome- missing X on 23rd pair

Inversion Insertion Deletion Translocation