GFP – LacZ alpha fusion presentation Overview of work done Questions I plan to answer [1] Scope of work [1] [1] Based upon discussion with Austin Che

GFP – LacZ alpha fusion presentation Overview of work done Questions I plan to answer [1] Scope of work [1] [1] Based upon discussion with Austin Che

Big picture : want dual reporter GFP ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

1. Hwang et al GFP – full length LacZ fusion : Works C-terminal GFP (red) 11 AA linker LacZ monomer 1 (Brown) N-terminal LacZ (yellow) LacZ monomer 2 (Purple) LacZ sub-units (purple and brown) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

2. Austin Che GFP and N-terminal LacZ alpha fusion : Doesn’t work Bba_E0050 C-terminal GFP (red) No linker LacZ alpha (blue) N-terminal LacZ (yellow) LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

3. Austin Che LacZ-alpha and N-terminal GFP fusion : Works Bba_E0051 N-terminal GFP (yellow) 18 AA linker C-terminal LacZ (red) LacZa was placed first in discussion with Joey Davis (Sauer lab). The subunit interfaces of lacZ are at the N-terminal residues and also lacZa is shorter and doesn't have any potential internal translation start sites wheras GFP might have some in-frame RBS and ATG which could possibly lead to translation of lacZa without GFP if GFP were first. The amino acid linker AGGSEGGGSEHHHHHHGSE is between the lacZa and GFP. The 6-his can also facilitate detection on a Western blot, for purification, etc. The start codon from GFP was removed. LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

4. Austin Che LacZ-alpha and N-terminal GFP variants Bba_E0051 Have this with 12 promoter / RBS combinations LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

GFP – LacZ alpha fusion presentation Overview of work done Questions I plan to answer [1] Scope of work [1] [1] Based upon discussion with Austin Che

Questions 1. Can E0051 be used to report promoter activity? Scope of work Receive E0051 from Austin PCR with BBa sites on primers and with RBS on forward primer Insert into flipee vector, downstream of promoter

2. Does re-designed E0050 fusion work? Scope of work Questions 2. Does re-designed E0050 fusion work? Scope of work Receive E0051 primer designs from Austin Design primers for PCR of LacZ and GFP, with linker / RBS PCR “stitch” to create E0050 with linker Bba_E0050 Insert linker

Questions 3. How d0 E0050 2.0, E0051, E0050, and full length fusion compare? Scope of my work based upon discussions with Austin Receive full length GFP fusion from Hwang group and E0050. Compare performance of constructs.

Questions 4. Are GFP/lacZ activities correlated independent of promoter/RBS? Scope of my work based upon discussions with Austin Evaluate on microplate reader.

Questions Can E0051 be used to report promoter activity? Does re-designed E0050 fusion work? How d0 E0050 2.0, E0051, E0050, and full length fusion compare? Are GFP/lacZ activities correlated independent of promoter/RBS? Scope of work Receive E0051, E0051, 12 E0051 variants, primer designs from Austin Receive full length GFP fusion from Hwang group PCR E0051 w/ BBa sites on primers and with RBS on forward primer Insert into flipee vector, downstream of promoter, test Design primers for PCR of LacZ and GFP, with linker / RBS PCR “stitch” to create an E0050 with linker Compare performance of E0050 2.0, E0051, E0050, Hwang fusion. Evaluate promoter/RBS variants on microplate reader.

Appendix I: Hwang et al

1. LacZ – GFP fusion : Hwang et al [1] show fusion protein between GFP and the N-terminal alpha fragment of full length lacZ + LacZ excised from pMC1817 by Pst1 MCS Pst1 GFP LacZ 11 amino acid linker EcoR1 TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAG [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

1. LacZ – GFP fusion : It works [1] ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.