The spleen contributes importantly to myocardial infarct exacerbation during post-ischemic reperfusion in mice via signaling between cardiac HMBG1 and.

Slides:

Advertisements

Similar presentations

Online Resource 1. Article title: Depletion of circulating blood NOS3 increases severity of myocardial infarction and left ventricular dysfunction Journal.

Advertisements

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

University “Federico II” of Naples - Dept. of Electronic Engineering and Telecommunications Biomedical Engineering Unit - Via Claudio, Napoli.

Galanin Protects from Caspase-8/12-initiated Neuronal Apoptosis in the Ischemic Mouse Brain via GalR1 Li Yun;Mei Zhu;Liu Shuiqiao;Wang Tong;Li Hui;Li Xiao-Xiao;Han.

Fig. 2. Neuroprotective effects of ex-4 through the G protein-coupled GLP-1 receptor. (A) Infarct volume was assessed by TTC staining after tMCAO in rats.

Fig. 4. TGF-α is one of the major cytokines in M2 conditioned media

Tumor necrosis factor-α does not modulate ischemia/reperfusion injury in naïve myocardium but is essential for the development of late preconditioning

CLARITY for High-resolution Imaging and Quantification of Vasculature in the Whole Mouse Brain Zhang Lin-Yuan 1 ;Lin #cod#x0002A;Pan 2 ;Pan Jiaji 3 ;Ma.

Aprotinin improves kidney function and decreases tubular cell apoptosis and proapoptotic signaling after renal ischemia-reperfusion Ajay Kher, MD, Kirstan.

Effect of Shikonin on Spinal Cord Injury in Rats Via Regulation of HMGB1/TLR4/NF-kB Signaling Pathway Cell Physiol Biochem 2017;43:481–491 - DOI: /

Galanin Protects from Caspase-8/12-initiated Neuronal Apoptosis in the Ischemic Mouse Brain via GalR1 Yun Li;Zhu Mei;Shuiqiao Liu;Tong Wang;Hui Li;Xiao-Xiao.

Cardioprotective Effect of a Hemoglobin-Based Oxygen Carrier on Cold Ischemia/Reperfusion Injury Cardiology 2011;120:73–83 - DOI: / Fig.

The novel exercise-induced hormone irisin protects against neuronal injury via activation of the Akt and ERK1/2 signaling pathways and contributes to.

Human Multipotential Bone Marrow Stem Cells Exert Immunomodulatory Effects, Prevent Splenic Contraction, and Enhance Functional Recovery in a Rodent Model.

Interruption of spinal cord microglial signaling by alpha-2 agonist dexmedetomidine in a murine model of delayed paraplegia Marshall T. Bell, MD, Viktor.

Vascular PPARδ Protects Against Stroke-Induced Brain Injury

Volume 92, Issue 2, Pages (August 2017)

Simvastatin attenuates cardiac isograft ischemia-reperfusion injury by down-regulating CC chemokine receptor-2 expression Rong Yin, MD, Jiaquan Zhu,

Ischemic cardiovascular involvement in psoriasis: A systematic review

Mary E. Huerter, MD, MA, Ashish K

Intramyocardial bone marrow stem cell transplantation during coronary artery bypass surgery: A meta-analysis Peter Donndorf, MD, Guenther Kundt, PhD,

Progranulin protects against renal ischemia/reperfusion injury in mice

Cardioprotective Effects of Combined Therapy with Hyperbaric Oxygen and Diltiazem Pretreatment on Myocardial Ischemia-Reperfusion Injury in Rats Cell Physiol.

Ischemic postconditioning protects the spinal cord from ischemia–reperfusion injury via modulation of redox signaling Wenying Song, MD, Jing Sun, MD,

Ischemic cardiovascular involvement in psoriasis: A systematic review

Supplementary Figure legends

Baiya Krishnadasan, MD, Babu V

Adenosine A2A receptor activation on CD4+ T lymphocytes and neutrophils attenuates lung ischemia–reperfusion injury Ashish K. Sharma, MBBS, Victor E.

Acute hyperglycemia enhances oxidative stress and exacerbates myocardial infarction by activating nicotinamide adenine dinucleotide phosphate oxidase.

Cytokines Link Toll-Like Receptor 4 Signaling to Cardiac Dysfunction After Global Myocardial Ischemia John Cha, MD, Zhiping Wang, MD, Lihua Ao, BS, Ning.

Tetramethylpyrazine protects spinal cord and reduces inflammation in a rat model of spinal cord ischemia-reperfusion injury Lihong Fan, MD, Kunzheng.

Volume 75, Issue 2, Pages (January 2009)

The Journal of Thoracic and Cardiovascular Surgery

The evolution of ischemic spinal cord injury in function, cytoarchitecture, and inflammation and the effects of adenosine A2A receptor activation T.

The Efficacy of Cardiac Anti-miR-208a Therapy Is Stress Dependent

Volume 87, Issue 1, Pages (January 2015)

Proteasome Inhibition Attenuates Infarct Size and Preserves Cardiac Function in a Murine Model of Myocardial Ischemia-Reperfusion Injury William E. Stansfield,

Injection of bone marrow mesenchymal stem cells in the borderline area of infarcted myocardium: Heart status and cell distribution Hao Zhang, MD, PhD,

Stefano Toldo et al. BTS 2017;2:

Altered cytokine production by Klrk1−/− NOD CTL

Endothelial microparticles exert differential effects on functions of Th1 in patients with acute coronary syndrome Yongguang Lu, Lang Li, Hua Yan, Qiang.

Gilbert R. Kinsey, Liping Huang, Amy L. Vergis, Li Li, Mark D. Okusa

Cardiac dysfunction induced by experimental myocardial infarction impairs the host defense response to bacterial infection in mice because of reduced.

M2b macrophages reduce early reperfusion injury after myocardial ischemia in mice: A predominant role of inhibiting apoptosis via A20 Yuan Yue, Xiao.

Adam C. Silver, Alvaro Arjona, Wendy E. Walker, Erol Fikrig Immunity

Novel regenerative therapy using cell-sheet covered with omentum flap delivers a huge number of cells in a porcine myocardial infarction model Yasuhiro.

Dandan Wang et al. BTS 2018;3: Cardiomyocyte-Specific Knock-In miR-24 Ameliorates Ischemia/Reperfusion Injury (A) Quantitative polymerase chain.

Supplementary Figure 1. Structure of amlexanox

Cardiac Fibrosis at 18 Weeks Post TAC (A) Representative images (original magnification ×20) of Picrosirius red-stained cardiac tissue sections from HF +

Stephen E. Gould, Maria Day, Simon S. Jones, Haimanti Dorai

Volume 139, Issue 4, Pages (October 2010)

Volume 32, Issue 5, Pages (May 2010)

Validating the use of short interfering RNA as a novel technique for cell-specific target gene knockdown in lung ischemia–reperfusion injury Heather.

Volume 29, Issue 1, Pages (July 2008)

Volume 79, Issue 2, Pages (January 2011)

Toll-like receptor 4 mediates ischemia/reperfusion injury of the heart

Syed M. Meeran, Thejass Punathil, Santosh K. Katiyar

CD4+ T lymphocytes mediate acute pulmonary ischemia–reperfusion injury

Volume 25, Issue 1, Pages (January 2017)

Role of the T-cell receptor in kidney ischemia–reperfusion injury

Volume 75, Issue 5, Pages (March 2009)

Smad3 Signal Transducer Regulates Skin Inflammation and Specific IgE Response in Murine Model of Atopic Dermatitis Minna Anthoni, Guoying Wang, Chuxia.

Standard mean difference of change in creatinine between the intravenous (IV) versus oral (PO) arm. Standard mean difference of change in creatinine between.

Inhibitory kappa B kinase-β is a target for specific nuclear factor kappa B-mediated delayed cardioprotection Nancy C. Moss, MD, Ru-Hang Tang, PhD, Monte.

Volume 137, Issue 6, Pages e2 (December 2009)

Acute nephrotoxic and obstructive injury primes the kidney to endotoxin-driven cytokine/chemokine production R.A. Zager, A.C.M. Johnson, S.Y. Hanson,

ประกาศกระทรวงอุตสาหกรรม ฉบับที่ 5292 (พ.ศ. 2562)

Molecular Therapy - Nucleic Acids

Volume 17, Issue 2, Pages (February 2009)

Presentation transcript:

The spleen contributes importantly to myocardial infarct exacerbation during post-ischemic reperfusion in mice via signaling between cardiac HMBG1 and splenic RAGE Yikui Tian1, 2, Dongfeng Pan3, Mahendra D. Chordia3, Brent A. French3,4, Irving L. Kron2, Zequan Yang2,4 Department of Cardiovascular Surgery1, Tianjin Medical University General Hospital, Tianjin, China; Departments of Surgery2, Radiology3, and Biomedical Engineering4, University of Virginia, Virginia, USA. Corresponding Author: Zequan Yang. Dept. of Surgery, University of Virginia, P.O. Box 800709, Charlottesville, VA 22908. Fax: (434)924-5923, Tel: (434)982-4411, Email: zy6b@virginia.edu

Online resource Table I Genes Primer sequences IL-1β-F AAATGATGGCTTATTACAGTGGC IL-1β-R GCTGTAGTGGTGGTCGGAGATT INF-γ-F GATGTAGCGGATAATGGAAC INF-γ-R GCAGGCAGGACAACCAT TNF-α-F CCGAGTGACAAGCCTGTAGCCC TNF-α-R CCCTTGAAGAGGACCTGGGAGTAGAT MCP-1-F CTCATAGCAGCCACCTTCAT MCP-1-R CTTCTTTGGGACACTTGCTG

Online resources Figure I # * The infarct size exacerbation effects of different concentration of IHH. (n=3-4 in each group) Mice underwent 20’/60’ IR injury. We tested 3 different concentrations of IHH combined with sham heart homogenate. Sham and 1ug/g IHH had no IF exacerbation effect. 5 ug/g IHH lightly increased myocardial infarct size. The 10 ug/g IHH was found giving the most significant exacerbation effect. Risk Region (RR) were identical among groups. *: p<0.05 compared with control, sham IHH and 1ug/g IHH groups. #: p<0.05 compared with other groups.

Online resources Figure II A B C D E F Risk Regions were identical among groups in all experiments for TTC staining. A: Risk regions for Figure 1A; B: Risk regions for Figure 1C; C: Risk regions for Figure 2 D: Risk Regions for Figure 3C; E Risk Regions for Figure 3D; F Risk Regions for Figure 6

Online resource Figure III Relative levels of mRNAs * * * * 40-IHH significantly increased mRNAs of cytokines in splenic leukocytes but not in bone marrow cells *: p<0.05 compared with Vehicle groups.

Online resources Figure IV * cFLFLF significantly reduced the myocardial infarct size in 40’/60’ IR mice. RR (Risk region) had no significant difference between two groups. * p<0.05 compared with the 40’/60’ IR group.