Lecture 6: Genotype by sequencing Statistical Genomics Lecture 6: Genotype by sequencing Zhiwu Zhang Washington State University

Outline Genetic markers Sequencing Full vs. reduced Experiment Data process and format

Human genome project Funded by DOE, NIH and Welcome Trust in the UK Begun in 1990 Original planed to last 15 years. Institute for Genomic Research and U. of Washington provided over 450K BAC each was tagged and contain 3~4 Kb across the entire human genome

Human genome project Accelerate the completion date to 2003 Celera Genomics Craig Venter was among those sequenced Identified 20~120K genes Sequence of 3 billion base pairs Cost near 3 billion dollars

Types of genetic markers RFLP: Restriction fragment length polymorphism SSR: Simple Sequence Repeats SNP: Single Nucleotide Polymorphism Chip Sequencing

RFLP Restriction Enzyme Restriction fragment length polymorphism

SSR

SNP by hybridization http://www.genome.gov/10000533

Fredric Sanger 1958 Nobel Price of Chemistry for Protein identification by electrophoresis 1980 Nobel Price of Chemistry for DNA sequencing

Ladder of DNA length dNTP (deoxynucleotides) ddNTP: (dideoxynucleotides): chain reaction terminator

1st Generation DNA sequencing Fred Sanger and Alan R. Coulson, Nature 24, 687–695 (1977)

2nd generation sequencing Sequencing-by-synthesis by 454 Life Science: Margulies, M. et al. Nature 437, 376–380 (2005). Multiplex Polony sequencing by George M. Church lab at Harvard Medical School: Shendure, J. et al. Science 309, 1728–1732 (2005). 1 2 3 4 5 6

Sequencing-by-synthesis 454 Life Science: Margulies, M. et al. Nature 437, 376–380 (2005). 1 2 3 4 5 6 T G C T A C … T T T T T T … http://en.wikipedia.org/wiki/File:Sequencing_by_synthesis_Reversible_terminators.png

Multiplex Polony sequencing George M. Church lab at Harvard Medical School: Shendure, J. et al. Science 309, 1728–1732 (2005). http://wjingpan.blog.sohu.com/140002432.html

Cluster Generation

$1000 Genome   Price Price/unit $/Genome* Consumables $/Gb HiSeq X Five $6M $1.2M $1,425 $1,200 $10.6 HiSeq X Ten $10M $1M $1,000 $800 $7 http://blog.genohub.com/illuminas-latest-release-hiseq-3000-4000-nextseq-550-and-hiseq-x5/

DNA/RNA fragmentation Physical Fragmentation 1) Acoustic shearing 2) Sonication 3) Hydrodynamic shear Enzymatic Methods 4) DNase I or other restriction endonuclease, non-specific nuclease 5) Transposase Chemical Fragmentation 6) Heat and divalent metal cation

Reduced Genotyping Sequencing Restriction site

Restriction enzymes: ApeKI Recognition: 5’GCWGC3’ W: A or T Expected size: 4x4x2x4x4=512bp= 0.5Kb Genome coverage 100 bp read/512 bp size=20%

Restriction enzymes: PstI Recognition: 5’ CTGCAG3’ Expected size: 4^6=4096bp= 4Kb Genome coverage 100 bp read/4096 bp size=2.5%

Multiplex barcode Aalborg University, Denmark: Craig et al. Nat. Methods 2000, 5: 887–893. 4~8 bases

Adapter and Barcode By Sharon Mitchell

Genotyping by sequencing (GBS) Digest DNA Ligate adapters with barcodes 5. Illumina sequencing 3. Pool DNAs 4. PCR . . Here, I need to make a brief introduction to genotyping by sequencing. This flowchart shows the protocol of GBS. The DNA samples are digested with enzyme and barcoded. Then we pool the DNA and do the PCR. Eventually the samples are sequenced in Illumina sequencer. This protocol is more simpler than the similar methods, like rrl and rad. Elshire et al. 2011. PLoS One

Cost reduction by multiplexing Besides, the GBS is cost effective. One sample only costs 9 dollors, if 384 plex is used. Considering the coverage, we used the 96 plex protocol on all the switchgrass samples.

Sequencing depth Definition: Expected sequencing times per base pair Calculation 100Mb genome, 100M read of 100 bp: 100X 3G genome, 1% reduced, 50 multiplex, 6G data (1byte one base): 6G/(50x3Gx1%)=4X

Genomic coverage and depth ApeKI PstI Recognition bases 5 6 Fragment size .5Kb 4Kb Genome coverage (100bp read) 20% 2.5% Number of unique sequence (3G genome) 3G/.5Kb=6M 3G/4Kb=.75M Sequencing depth (60G data on 3G genome) 60/(3x.2)=100X 60/(3*.025)=800X

Distribution of length Expectation of length=length/number of cut Variance=Squared Expectation (need proof)

Distribution of length size=300000000 x=round(runif(n,1,size)) y=sort(x) interval=y[-1]-y[-n] hist(interval) Ex=size/n Va=Ex*Ex m=mean(interval) v=var(interval) m v

Distribution of length Beissinger et al, Genetics. 2013, 193(4):1073-81

Number of reads

FASTQ Line 1: start with @ followed by sequence description @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC Line 1: start with @ followed by sequence description Line 2: Sequence Line 3 start with + followed by description Line 4: Symbols of sequence quality values (same length as sequence) with ! the lowest and ~ the highest. There are 94 symbols with ascii code from 33 to 126. !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

Ascii code x CHAR(x) 33 ! 56 8 80 P 103 g 34 " 57 9 81 Q 104 h 35 # 58 : 82 R 105 i 36 $ 59 ; 83 S 106 j 37 % 60 < 84 T 107 k 38 & 61 = 85 U 108 l 39 ' 62 > 86 V 109 m 40 ( 63 ? 87 W 110 n 41 ) 64 @ 88 X 111 o 42 * 65 A 89 Y 112 p 43 + 66 B 90 Z 113 q 44 , 67 C 91 [ 114 r 45 - 68 D 92 \ 115 s 46 . 69 E 93 ] 116 t 47 / 70 F 94 ^ 117 u 48 71 G 95 _ 118 v 49 1 72 H 96 ` 119 w 50 2 73 I 97 a 120 51 3 74 J 98 b 121 y 52 4 75 K 99 c 122 z 53 5 76 L 100 d 123 { 54 6 77 M 101 e 124 | 55 7 78 N 102 f 125 } 79 O 126 ~

Post-sequencing http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0101025

Hapmap format IUPAC code

Genotype in Numeric format myGD=read.table(file="http://zzlab.net/GAPIT/data/mdp_numeric.txt",head=T)

Genetic map myGM=read.table(file="http://zzlab.net/GAPIT/data/mdp_SNP_information.txt",head=T)

Outline Genetic markers Sequencing Full vs. reduced Experiment Data process and format