Restriction Digestion and Analysis of Lambda DNA Kit

What can you do with the Restriction Digestion and Analysis of Lambda DNA Kit? Understand the use of restriction enzymes as biotechnology tools and the mechanics of a restriction enzyme digest Become familiar with principals and techniques of agarose gel electrophoresis Estimate DNA fragment sizes from agarose gel data Understand the importance of restriction enzymes and their applications

What are restriction enzymes? Evolved by bacteria to protect against viral DNA infection 1950s: discovery of primitive immune system in bacteria 1962: proof that in bacteria, an enzyme system recognized and destroyed foreign DNA while protecting its own 1960s: E.coli extracts isolated which cleaved phage DNA, but not useful 1970s: H. influenzae, HindII, extract isolated with no modification activity and cleavage within the restriction site Endonucleases = cleave within DNA strands Exonucleases = digest from the ends of DNA molecules Types I, II, and III 3,139 known enzymes

How does it work? Enzyme Site Recognition Each enzyme digests (cuts) DNA at a specific sequence  restriction site Enzymes recognize 4-, 6- or 8- base pair, palindromic sequences Isoschizomers recognize identical sequences, but have different optimum reaction conditions and stabilities Can be unambiguous or ambiguous Unambiguous Ambiguous

Palindromic Sequences 5’ versus 3’ overhang: Sticky Ends, subsequent ligation is very specific Enzyme cuts  5’ GAATTC 3’ 3’ CTTAAG 5’ 5’ G 3’ 3’ CTTAA 5’ 5’ AATTC 3’ 3’ G 5’ Generates 5’ overhang (in the 5’ direction) Blunt ends: subsequent ligation is non-specific 5’ GAA TTC 3’ 3’ CTT AAG 5’ View the molecular structure of DNA (see the 5’ to 3’ structure): http://207.207.4.198/pub/flash/24/menu.swf

Common Restriction Enzymes 5’ GAATTC 3’ 3’ CTTAAG 5’ EcoRI Escherichia coli 5’ overhang HindIII Haemophilus influenzae 1st free-living organism to have its entire chromosome sequenced Type b, Hib, was the leading cause of bacterial meningitis among children under 5 years old in the US, before development of a vaccine. PstI Providencia stuartii 3’ overhang 5 species of Providencia recognized today: P stuartii is the most common species causing human infection. Extremely common in patients with long-term indwelling urinary catheters due to Its ability to persist in catheterized urine because its genetics allows it adhere to the urinary catheter. 5’ AAGCTT 3’ 3’ TTCGAA 5’ 5’ CTGCAG 3’ 3’ CACGTC 5’

Examples Eco RI Hae III GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT Eco RI GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCA CCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT Hae III GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCA CC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT

What is needed for restriction digestion? Template DNA, uncut DNA, often bacterial phage DNA Restriction enzyme(s), to cut template DNA Restriction Buffer, to provide optimal conditions for digestion Water Bath

Lambda Phage DNA Genomic DNA of a bacterial virus Attacks bacteria by inserting its nucleic acid into the host bacterial cell Replicates rapidly inside host cells until the cells burst and release more phages Harmless to man and other eukaryotic organisms

Bacteriophage lambda (λ) In 1971 Alan Campbell showed that the central third of the genome was not required for lytic growth. People started to replace it with E. coli DNA

Lambda genome is approximately 49 kb in length. Only 30 kb is required for lytic growth. Thus, one could clone 19 kb of “foreign” DNA. Packaging efficiency 78%-100% of the lambda genome. Legend: The linear double-stranded DNA lambda genome contains about 50,000 nucleotide pairs and encodes 50-60 different proteins. When the lambda DNA enters the cell the ends join to form a circular DNA molecule. The bacteriophage can multiply in E. coli by a lytic pathway, which destroys the cell, or it can enter a latent prophage state. Damage to a cell carrying a lambda prophage induces the prophage to exit from the host chromosome and shift to lytic growth (green arrows). The entrance and exit of the lambda DNA from the bacterial chromosome are site-specific recombination events. A complete animation of the lytic cycle: http://www.blackwellpublishing.com/trun/artwork/Animations/Lambda/lambda.html

COS site: Cohesive “sticky” ends Bacteriophage lambda Protein capsule of lambda has a tight constraint on the amount of DNA that will fit inside it (~ 55kb) By the early 1970’s we knew that a good portion of lambda was not required “Junk” DNA COS site: Cohesive “sticky” ends Lysis Head Replication ori Tail Circularized lambda Lysogeny

Not Quite Bacteriophage lambda COS Lysis Head Tail Replication ori Eliminate the non-essential parts of lambda Can now insert large pieces of DNA (~ 20 kb)

Restriction Enzyme Digestion Restriction Buffer provides optimal conditions: NaCl provides correct ionic strength Tris-HCl provides the proper pH Mg2+ is an enzyme co-factor Different enzymes have different optimal buffers; Manufacturers package enzymes with buffers for ease of use

DNA Digestion Temperature Why incubate at 37C? Body temperature is optimal for these and most other enzymes What happens if temperature is too hot or cool? Too hot = enzyme may be denatured, killed Too cool= enzyme activity lowered, requiring longer digestion time

How do we visualize the DNA? Agarose Gel Electrophoresis

Agarose Gel Electrophoresis Electrolysis: the splitting of water using electricity current splits water into hydrogen ions (H+) and hydroxyl ions (OH-) Electrophoresis: a method of separating charged molecules in an electrical field; DNA has an overall negative charge Used to separate DNA fragments by size

Components of an Electrophoresis System Power supply and chamber, a source of negatively charged particles with a cathode and anode Buffer, a fluid mixture of water and ions Agarose gel, a porous material that DNA migrates through Gel casting materials DNA ladder, mixture of DNA fragments of known lengths Loading dye, contains a dense material and allows visualization of DNA migration DNA Stain, allows visualizations of DNA fragments after electrophoresis Ions: atoms that have a positive or negative charge because they have lost or gained electrons. Electrophoresis: migration of ions at different speeds is a basic principal

- + Cathode Anode Buffer Dyes Agarose gel Power Supply During electrophoresis, water is electrolyzed which generates protons (H+ ions)at the anode (positive) and hydroxyl ions (OH -1)at the cathode (negative). The cathode (negative) end of the electrophoresis chamber then becomes basic and the anode (positive) end becomes acidic. The electrode at which electrons enter the gel box from the power supply (along the black wire) is called the cathode and is negative (-). The electrode at which electrons leave the box and re-enter the power supply (along the red wire) is called the anode and carries a positive charge (+). The flow of electrons sets up a potential energy difference between the electrodes. This is known as potential, and is measured in volts. It establishes an electric field through which the ions in the gel box fluid migrate. The migration of ions in the fluid creates electrical current which is measured in milliamperes (milliamps).

Bio-Rad’s Electrophoresis Equipment Power Supplies Precast Ready Agarose Gel

Electrophoresis Buffer TAE (Tris-acetate-EDTA) and TBE (Tris- borate-EDTA) are the most common buffers for duplex DNA Establish pH and provide ions to support conductivity Concentration affects DNA migration Use of water will produce no migraton High buffer conc. could melt the agarose gel A buffer is a chemical system that maintains a relatively constant pH even when strong acids or bases are added. Buffer solutions contain either a weak acid or weak base and one of their salts. Because a change in pH can alter the charge on a particle, it is important to use a buffer solution when separating during electrophoresis.

Agarose Gel A porous material derived from red seaweed Acts as a sieve for separating DNA fragments; smaller fragments travel faster than large fragments Plinko Model Concentration affects DNA migration Low conc. = larger pores better resolution of larger DNA fragments High conc. = smaller pores better resolution of smaller DNA fragments 1% agarose 2% agarose

Loading Dye DNA samples are loaded into a gel AFTER the tank has been filled with buffer, covering the gel Contains a dense substance, such as glycerol, to allow the sample to "fall" into the sample wells Contains one or two tracking dyes, which migrate in the gel and allow monitoring of how far the electrophoresis has proceeded.

DNA Staining Allows DNA visualization after gel electrophoresis Ethidium Bromide Bio-Safe DNA stains

Complete a Gel Electrophoresis simulation at: Agarose Gel DNA Fragments Complete a Gel Electrophoresis simulation at: http://gslc.genetics.utah.edu/units/biotech/gel/

Restriction Enzyme Digest and Analysis Procedures

Actual Results of Restriction Enzyme Digestion Lane 1, DNA markers (HindIII lambda digest) lane 2, uncut lambda DNA lane 3, lambda DNA digested with PstI lane 4, lambda DNA digested with EcoRI lane 5, lambda DNA digested with HindIII

Analysis of DNA Fragments Determine restriction fragment sizes Create standard curve using DNA marker Measure distance traveled by restriction fragments Determine size of DNA fragments

DNA Marker Standard Curve Size (bp) Distance (mm) 23,000 11.0 9,400 13.0 6,500 15.0 4,400 18.0 2,300 23.0 2,000 24.0

Factors Affecting Restriction Enzyme Digestion Temperature, restriction enzymes are sensitive to prolonged periods of exposure to heat Cross contamination of restriction enzymes Buffer, optimum pH Incubation temperature, maintain optimum temperature during restriction enzyme activity And Finally…Don’t forget to ADD your restriction enzyme to the reaction!!!

Applications Recombinant DNA Technology DNA Cloning Constructing DNA Libraries Southern Blot Hybridization

Gene Cloning

Southern Blot Hybridization DNA is isolated from a sample such as blood, saliva, semen, tissue, or hair and purified The huge genome is cut up with restriction enzymes to produce short, manageable DNA fragments DNA fragments are then sorted by size using gel electrophoresis DNA is denatured and transferred and permanently affixed to a nylon membrane Attach a radioactive, DNA probe that is complementary to a VNTR locus to DNA sequences on the membrane Take a picture of it using special X-ray film

“High-profile” Applications Forensics (CSI) – “Can you find a match?” Crime Scenes Paternity Human Remains Genome Projects Biological Weapons “Low-profile” Applications Can you find similarities? Organ Transplants Anthropology and Human Relatedness Species Relatedness Food Identification

Genome Sequencing Paternity Analysis No 2 individuals have the same pattern of restriction enzyme recognition sites Silent mutations on alleles and RFLP’s

Crime Scene Investigation VNTR’s: number of repeats varies from 4 to 40 in different individuals Variants inherited from parents; unrelated individuals not likely to have same repeats Length of DNA depends on the number of repeats at each locus Same 3 VNTR loci are analyzed for 3 individuals = 6 bands for each Results can serve as a DNA fingerprint to exclude suspects