The Suspects Will, Captain of the Football Team Liza, Head Cheerleader Jude, Senior Class President Natalie, Valedictorian Molly, Rival High Homecoming Queen Maggie, Lead actress in school play Vince, Drum Major
Restriction Enzyme Digestion Analysis EcoRI cuts the following sequence: G|AATTC Find all EcoRI cut sites in the DNA sequence of the suspect you represent Draw the bands on the gel according to their predicted lengths following digestion Can we ID the thief??
TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA Suspect #1: Will DOB: 07/11/1989 Sex: Male Weight: 220 lb. Height: 6’1” Position: Captain of the Football Team DNA Sequence: TCGATGAATTCTATCGGAATTCTCGGACTTCTCGAGAATTCTGCGGATTTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATGAATTCTATCGCAATTCTCGCAATTCTCGAGAATTCTGCGGATTTCTCGGATTCA Suspect #2: Natalie DOB: 06/19/1990 Sex: Female Weight: 125 lb. Height: 5’6” Position: Class of 2007 Valedictorian DNA Sequence: TCGATGAATTCTATCGCAATTCTCGCAATTCTCGAGAATTCTGCGGATTTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATGAAGTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA Suspect #3: Molly DOB: 09/15/1989 Sex: Female Weight: 145 lb. Height: 5’11” Position: Rival High Homecoming Queen DNA Sequence: TCGATGAAGTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATCAATTCTATCGGAATTCTCGGATTTCTCGACAATTCTGCGGAATTCTCGGATTCA Suspect #4: Jude DOB: 03/14/1989 Sex: Male Weight: 190 lb. Height: 5’10” Position: Senior Class President DNA Sequence: TCGATCAATTCTATCGGAATTCTCGGATTTCTCGACAATTCTGCGGAATTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATGAATTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA Suspect #5: Maggie DOB: 05/03/1990 Sex: Female Weight: 140 lb. Height: 5’8” Position: Lead actress in school play DNA Sequence: TCGATGAATTCTATCGGAATTCTCGGAATTCTCGACAATTCTGCGGAATTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATGAATTCTATCGAAATTCTCGGAATTCTCGAGAATCCTGCGGACTTCTCGGATTCA Suspect #6: Vince DOB: 08/11/1989 Sex: Male Weight: 210 lb. Height: 6’2” Position: Drum Major DNA Sequence: TCGATGAATTCTATCGAAATTCTCGGAATTCTCGAGAATCCTGCGGACTTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
TCGATGAACTCTATCGGAATTTTCGGAATTCTCGAGATTTCTGCGGAATTCTCGGATTCA Suspect #7: Liza DOB: 02/28/1989 Sex: Female Weight: 110 lb. Height: 5’3” Position: Head Cheerleader R DNA Sequence: TCGATGAACTCTATCGGAATTTTCGGAATTCTCGAGATTTCTGCGGAATTCTCGGATTCA DNA Fragment Sizes: _________________ 1 35 30 28 24 20 16 10 12 5 M Thief EcoRI: G|AATTC
Who done it?
35 30 28 24 20 16 12 10 5 1 Crime Scene DNA Suspect #2: Natalie Suspect #1: Will Suspect #3: Molly Suspect #4: Jude Suspect #5: Maggie Suspect #6: Vince Suspect #7: Liza DNA Ladder 35 30 28 24 20 16 ****If you don’t have a preprinted poster of a blank gel, make sure you draw a gel on the board for them to fill in if you are using powerpoint. Alternatively, use the blank gel on this slide printed on an overhead ***** Pass out a suspect sheet to each student. Have each student go through and find all the EcoRI cut sites, determine the size of each fragment, and draw the DNA pieces on the gel. Have the students with the same suspect get together and compare their EcoRI digestion analysis. Have one representative from each group go to the board and drawn their digestion pattern on the gel. Identify the thief as a class. 12 10 5 1