Can we cripple an antibiotic resistance system expressed by beta-lactam resistant Neisseria gonorrhoeae? S Chen, K Connolly, SM Zughaier, AE Jerse, WM Shafer Emory University School of Medicine, Atlanta, GA and Uniformed Services University of the Health Sciences Penicillin: 1944-1985 Support from: R37 AI21150-33 (WMS) U19 AI113170-03 (AEJ)

T Neisseria gonorrhoeae and Antimicrobial Resistance: “Urgent Threat” and “Super-Bug” Pathogen Unemo and Shafer 2014

Fighting Back: Current Efforts Against N. gonorrhoeae New drug discovery Clinical trials underway Vaccine efforts as a parallel track - Adjunctive therapeutics - New combinations of existing antibiotics

Why study mechanisms of resistance? May help in design in newer antimicrobials and vaccines Provides insights as to development of compensatory mutations that reverse fitness defects yet keep resistance Informs on likely development of resistance to new antibiotics We concentrate on multidrug efflux pumps

Gonococcal Efflux Pumps and Antimicrobial Substrates

Importance of the Mtr Efflux System Contributes to resistance to host-derived antimicrobials and is necessary for in vivo survival as assessed using an experimental female mouse model of lower genital tract infection (Jerse et al. 2003). Required for chromosomally-determined resistance of gonococci to beta-lactams and other antibiotics (e.g., macrolides) (Veal et al. 2002 & Golparian et al. 2015). Might inhibitors of the Mtr pump or dampening of pump expression allow for a return of penicillin or increase longevity of currently antibiotics? Also, could this strategy also enhance natural host clearance of gonococci independent of antibiotics?

penB PmtrR FA6140 penA4 HO41 penA41 ponA Shafer, Folster & Ceftriaxone Antibiotic Efflux Outer Membrane PorB1B Overexpression Activates PorB1B Mutations Decreased Influx penB PmtrR MtrCDE Efflux Pump Decreased Inactivation FA6140 penA4 HO41 penA41 Shafer, Folster & Nicholas 2009. This slide summarizes in graphic form the various known resistance determinants and how resistance works. The structures here are either from GC—PBP 2—or are closely related to their GC homolgoues. Remodeled PBP 2 ponA PBP 1 Cytoplasmic Membrane

MtrR Regulation of the mtrCDE Efflux Pump-Encoding Operon mtrF mtrR mtrC mtrD mtrE 250 bp GC P MtrR -35 -10 ATTATAAAAAAGACTTTTTATCCGTGCAATCGTGTATGTATAATGAAACCCATA TAATATTTTTTCTGAAAAATAGGCACGTTAGCACATACATATTACTTTGGGTAT -10 -35 13 bp IR and site of single bp deletion (T:A bp) found in 15-20% of clinical isolates that are antibiotic resistant

Regulation of mtrCDE Expression WT bp∆ ∆mtrR mtrR::km Hagman & Shafer. 1995. J. Bacteriol.

H041: Japan, 2009 Ohnishi et al (2011)

Loss of MtrCDE Reverses Clinical Resistance Outer membrane Inner Periplasm MIC X Wendy Veal 2002 Magnus Unemo Ph.D. and lab Orebro, Sweden

Expression of wild-type mtrR in HO41 reverses penicillin resistance HTH MS11: mtr120 (-10) Inverted Repeat -35mtrC -10mtrC TATAAT CAT....ATTATAAAAAAGACTTTTTATCCGTGCAATCGTGTATGTATATT....TATAAC....ATG -10mtrR -35mtrR mtrR mtrC HO41 Shao-chun Chen Ph.D. expressed wild-type mtrR from a second site on the HO41 chromosome under an IPTG-inducible promoter: monitored resistance to beta-lactams as well as levels of MtrR and MtrE.

SC6 is HO41 mtrR+ anti-MtrR anti-MtrE MtrR decreases MtrE Levels kDa FA19 SC6 IPTG- IPTG+ HO41 FA19 SC6 IPTG- IPTG+ kDa 204 130 92 38 MtrE 31 MtrR 18 7 SC6 is HO41 mtrR+

MIC µg/ml

Use of CRO as “Proof of Principle” Theoretical 30.5 16.4 28.1 20.1 SC6 = H041 mtrR+ rpsL SC7= H041 rpsL Kristie Connolly, Ph.D., USUHS Ann Eakin, Ph.D., NIAID PK modeling was used to predict dosing regimen that will give plasma levels above the MIC of each strain for > 24 hrs. Two regimens were predicted to be effective against SC6 but not SC7 - 60 mg/kg, TID - 120 mg/kg BID Ceftriaxone; CRO

Sub-Inhibitory Doses of Cro Completely Clear H041 from Mice within 48 Hours when H041 Expresses MtrR n.s. p 0.02 p < 0.0001 CRO every 8 hours CRO every 12 hours

Conclusions And The Future Gonococci have a remarkable ability to develop resistance to antibiotics used in therapy and active surveillance systems are essential to detect changes in susceptibility The MtrCDE drug efflux contributes significantly to such resistance Transcriptional control systems modulate levels of efflux pump gene expressions and, as a consequence, levels of antibiotic resistance Mutations that increase efflux pump gene expression can significantly impact clinical efficacy of antibiotics Dampening efflux pump gene expression might allow for return of an old antibiotic (Pen) or allow for continued use of a current antibiotic (Cro)