Cancer Prevention and Screening

Slides:



Advertisements
Similar presentations
CANCER SCREENING 2011 DELAWARE CANCER EDUCATION ALLIANCE STEPHEN S. GRUBBS, M.D. HELEN F. GRAHAM CANCER CENTER DELAWARE CANCER CONSORTIUM OCTOBER 5, 2011.
Advertisements

Breast Cancer Screening:
© Food – a fact of life 2009 Diet and cancer prevention Extension.
Bite-sized provision: how small is small ? Prof. Peter Crossley Director of the Joule Centre University of Manchester.
HSS4303B March 25, 2010 Erin Russell MSc. Candidate, Epidemiology
The Burden of Cancer and an Action Plan for Change in Monroe County January 2013 Byron Kennedy, MD, PhD, MPH Deputy Director of Health Monroe County, NY.
What women can do to stay healthy Valerie Beral University of Oxford THE MILLION WOMEN STUDY.
Cancer Program Standards 2012: Ensuring Patient-Centered Care
Cancer Prevention Dr Brenda Wilson Department of Epidemiology & Community Medicine.
Cohort Studies Dr. Amna Rehana Siddiqui & Prof Awatif Alam Prof Ashry Gad Department of Family & Community Medicine September 2013.
HEAPHY 1 & 2 DIAGNOSTIC James HAYES Fri 30 th Aug 2013 Session 2 / Talk 4 11:33 – 12:00 ABSTRACT To estimate population attributable risks for modifiable.
| Strathmore University Medical Centre Cancer Awareness Month October 2013.
HOW TO CONTROL CANCER Putting Science into Practice.
Dr Jesme Baird The Roy Castle Lung Cancer Foundation, UK and ECPC.
A Profile of Health among Massachusetts Adults: Highlights from the Massachusetts Behavioral Risk Factor Surveillance System (BRFSS) Health Survey.
Zonal Nursing at the Ayr Clinic Hugh Hill & James Dalrymple Movember 2012.
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCC TGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
Why Screening? Improvement Facilitator Training Session 1 Day 1.
5 Most Common Cancers. 1 in 2 men and 1 in 3 women in Australia will be diagnosed with cancer before the age of 85.
Role of the Surgeon in Cancer Management A. Responsible for the initial diagnosis and management of solid tumors. B. Responsible for the Definitive Surgical.
Associated Web sites CustomizableMaps The Atlas On-Line.
Cancer. Death rates (for both men & women) Lung = Highest Colorectal = Second highest 1/2 Of all cancer deaths from  Lung  Colorectal  Breast  Prostate.
Dr Heather O Dickinson Department of Child Health University of Newcastle
Cancer 101: A Cancer Education and Training Program for [Target Population] Date Location Presented by: Presenter 1 Presenter 2.
Be a Partner with Your Physician Stephen TePastte M.D. Medical Director MESSA.
Cancer. Neoplastic cells Benign –Localized Malignant –Spreads Move (metastasize) through –Blood or lymph systems.
Epidemiology 242: Cancer Epidemiology Zuo-Feng Zhang, MD, PhD Fall Quarter, 2009.
We can beat cancer Awareness and Prevention Guide.
50 Shades of Pink From your Oxford Centric team. Mississippi: Now and Beyond.
Smoking in The United States Alexandra M. Lippert 1/30/13 ECO 5550 Presentation.
Knowledge we should know about CANCER Group members: 吳俊諺 、 謝淯存 、 郭玠廷 、 王珮瑜.
How Do We Individualize Guidelines in an Era of Personalized Medicine? Douglas K. Owens, MD, MS VA Palo Alto Health Care System Stanford University, Stanford.
CANCER CAUSES, REMEDIES & PREVENTION
Opinions After I read the following statements, go stand next to the sign that expresses your viewpoint – either Strongly Agree, Agree, Disagree, or Strongly.
The Changing Face of Cancer in Iowa
The smoking epidemic and lung cancer in the EU
A Search For Better Health Topic 11: Epidemiology
Well Child Care.
Florida’s Top 5 Causes of Deaths
Breast Cancer Awareness
Survival in most affluent
We can beat cancer Awareness and Prevention Guide.
World Health Organization
Patient Navigation Process
Head of Policy and Public Affairs
Endometrial and other cancers in the menopause
My CancerIQ™ -- cancer prevention goes digital in Ontario (Feb. 2015)
NCD Control Programmes
Breast Health Katherine B. Lee, MD, FACP April 26, 2018.
HEALTH PROFESSIONAL ENGAGEMENT PROGRAMME:
Prevention and Early Diagnosis of Cancer Ongar Health Centre Patient Forum 7th March 2018 Sue White Cancer Research UK Facilitator.
SMG PPG Meeting 21st April 2018
Lung Cancer in Lewisham
Loneliness at Older Ages What does the research tell us?
National Diabetes Strategy Updates Dr. Al Anoud Mohammed Al-Thani
سرطان الثدي Breast Cancer
How can we identify a novel carcinogen?
Volume 384, Issue 9945, Pages (August 2014)
The Changing Face of Cancer in Iowa
Gender and Tobacco.
Standard 3.1 Patient Navigation Process
Lesson Starter Health inequalities are result of poor lifestyle CHOICES rather than poor lifestyle CHANCES. Do you agree with this statement? Why/ why.
Breast Cancer Guideline Update – Sharp Focus on Who is at Risk
AVOID the word “causes” in
Should Never-Smokers at Increased Risk for Lung Cancer Be Screened?
Citation: Cancer Care Ontario
Demographic and Epidemiological Transition and Cancer in India
Siwei Zhang Rongshou Zheng
Topics in Clinical Medicine 2 (TCM2)
Presentation transcript:

Cancer Prevention and Screening Stephen Duffy Module lead Ivana Sestak Deputy

Module contents Methods of epidemiological research How to ascertain the causes of disease? Common causes of cancer Prevention strategies Evaluation and implementation Screening for cancer

Epidemiological methods Discovery of the correlates and cancer Who gets it and who doesn’t? Age, sex, geography How to establish causal action? Affluent women have higher rates of breast cancer than deprived women, but WHY?

Cancer Prevention Can we change lifestyles to prevent cancer? Smoking Obesity Alcohol Chemoprevention Hormones to prevent breast cancer Vaccines against pathogens causing cancer

Question Smoking is estimated to cause 20% of cancers Does this mean that if a smoker gives up smoking the best to be hoped for is a 20% reduction in cancer risk?

Cancer Screening Complexities of evaluation Lead time, delayed benefit Screening in practice in the UK Breast Cervix Colorectum Potential other cancer screening activities Prostate, lung, ovary

Course structure Unit Value: 0.5 Total Student Study Hours: 75 Taught Hours: 15 Private Study Hours: 50-60 Courses: MSc Cancer Therapeutics MSc Molecular Pathology & Genomics Semester: Two Timetable: Tuesday 12:30 – 14:00 Summary of Assessment Method: Exam (60%) In Course Assessment – 40%

Course structure Lectures – about 5 sessions Small tutorial groups of between 6-8 students – about three sessions

Thank you