Comparative Genomics.

Slides:

Advertisements

Similar presentations

Mo17 shotgun project Goal: sequence Mo17 gene space with inexpensive new technologies Datasets in progress: Four-phases of 454-FLX sequencing to max of.

Advertisements

Distributed Annotation System Version 2 Allen Day, UCLA Anthony Cox, EBI Gregg Helt, Affymetrix Andrew Dalke, Dalke Scientific Lincoln Stein, CSHL.

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program.

ABSTRACT WormBase is a freely available information resource primarily for the nematode Caenorhabditis elegans but which progressively includes data from.

Genomic Innovations- Orthology Paralogy. Genomic innovation.

Gramene Comparative & Phylogenomics Resources for Plants Joshua C. Stein 1, William Spooner 1, Sharon Wei 1, Liya Ren 1, Doreen Ware 1,2 1 Cold Spring.

Basic Genomic Characteristic  AIM: to collect as much general information as possible about your gene: Nucleotide sequence Databases ○ NCBI GenBank ○

Basics of Comparative Genomics Dr G. P. S. Raghava.

Comparative genomics Joachim Bargsten February 2012.

Anthony Rogers* WormBase Consortium *Wellcome Trust Sanger Institute California Institute of Technology Cold Spring Harbor Laboratory Washington University.

M ulti P aranoid Automatic Clustering of Orthologs and Inparalogs Shared by Multiple Proteomes Andrey Alexeyenko Ivica Tamas Gang Liu Erik L.L. Sonnhammer.

Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

Finding Orthologous Groups René van der Heijden. What is this lecture about? What is ‘orthology’? Why do we study gene-ancestry/gene-trees (phylogenies)?

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein.

Comparative Genomics Tools in GMOD GMOD.org Dave Clements 1, Sheldon McKay 2, Ken Youns-Clark 2, Ben Faga 3, Scott Cain 4, and the GMOD Consortium 1 National.

EBI is an Outstation of the European Molecular Biology Laboratory. Bert Overduin Daniel Rios Stephen Fitzgerald Edinburgh, 24 & 25 February 2009 Ensembl.

Chapter 26: Phylogeny and the Tree of Life Objectives 1.Identify how phylogenies show evolutionary relationships. 2.Phylogenies are inferred based homologies.

The new VectorBase: our improved resource for invertebrate vectors Scott Emrich On behalf of VectorBase “bigger, better, faster” Or “ "consolidate, improve.

UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.

GMOD/GBrowse_syn Sheldon McKay iPlant Collaborative DNA Learning Center Cold Spring Harbor Laboratory.

GMOD: Managing Genomic Data from Emerging Model Organisms Dave Clements 1, Hilmar Lapp 1, Brian Osborne 2, Todd J. Vision 1 1 National Evolutionary Synthesis.

DAY 1c: Accessing Completed Genomes 1. UCSC Genome Bioinformatics 2. Ensembl 3. NCBI Genomic Biology.

8.1.4 Can it still be factored? Factoring Completely I can factor out a common factor.

Bioinformatic Tools for Comparative Genomics of Vectors Comparative Genomics.

Identification of Ortholog Groups by OrthoMCL Protein sequences from organisms of interest All-against-all BLASTP Between Species: Reciprocal best similarity.

GMOD/GBrowse_syn Sheldon McKay Reactome Ontario Institute for Cancer Research.

Importing Community annotations into VectorBase. Aims Provide the VectorBase community with tools for improving genome annotation. Must have low entry.

Building WormBase database(s). SAB 2008 Wellcome Trust Sanger Insitute Cold Spring Harbor Laboratory California Institute of Technology ● RNAi ● Microarray.

Orthology & Paralogy Alignment & Assembly Alastair Kerr Ph.D. [many slides borrowed from various sources]

P HYLO P AT : AN UPDATED VERSION OF THE PHYLOGENETIC PATTERN DATABASE CONTAINS GENE NEIGHBORHOOD Presenter: Reihaneh Rabbany Presented in Bioinformatics.

Curation Tools Gary Williams Sanger Institute. SAB 2008 Gene curation – prediction software Gene prediction software is good, but not perfect. Out of.

Data Mining in Ensembl with BioMart Giulietta Spudich.

BAC Sequencing and Annotation: Procedure Updates and New Tools Robert Buels.

Introduction to the Gene Ontology GO Workshop 3-6 August 2010.

Orthologs, Diseases, and Interactions Norie de la Cruz.

Orthology & Paralogy Alignment & Assembly Alastair Kerr Ph.D. WTCCB Bioinformatics Core [many slides borrowed from various sources]

Today in MEGA: Sequence Data Explorer Constructing Phylogenetic Trees

By Michael Han Sanger Wormbase Group SAB 2008 Comparative Genomics with.

Maize Genome Project Shiran Pasternak January 13, 2006 Gramene SAB Meeting San Diego, CA Shiran Pasternak January 13, 2006 Gramene SAB Meeting San Diego,

Advisory Board Meeting, CSHL 2005 Developments at Sanger Anthony Rogers Wellcome Trust Sanger Institute.

Bioinformatics Workshops 1 & 2 1. use of public database/search sites - range of data and access methods - interpretation of search results - understanding.

Advisory Board Meeting, Caltech 2004 Genome Sequence Updates. Paul Davis The Sanger Institute.

Central hub for biological data UniProtKB/Swiss-Prot is a central hub for biological data: over 120 databases are cross-referenced (EMBL/DDBJ/GenBank,

Sequence Curation Paul Davis Sanger Institute. Overview Sequence curation within WormBase consortium. Import of sequence data. Prediction stats. Work.

Comparative Genomics with GBrowse_syn Sheldon McKay.

Gene Regulation Xiaodong Wang Erich Schwarz WormBase at Caltech 2008 Advisory Board Meeting.

GMOD/GBrowse_syn Sheldon McKay iPlant Collaborative DNA Learning Center Cold Spring Harbor Laboratory.

The State of GMOD March 2011 GMOD Meeting US National Evolutionary Synthesis Center (NESCent) 5 March 2011 Sponsored by Scott Cain GMOD Project Coordinator.

Aequatus-vis Anil Thanki Scientific Programmer –

Advisory Board Meeting, Caltech 2004 Sequence curation in WormBase Sanger Institute, Hinxton & GSC, St Louis.

Data Loading into Ensembl Database TGAC Browser

Introduction to Genes and Genomes with Ensembl

Tools For Vertebrate Gene Naming

VectorBase genome annotation

Bioinformatics Tools for Comparative Genomics of Vectors

Basics of Comparative Genomics

TSS Annotation Workflow

Ensembl Genome Repository.

Updates and Future Direction

Monday’s Writing Topic ~ Week 20 – January 25 – 29 ~

Pairwise Sequence Alignment

Genetic Data in Mary Ann Tuli.

1. C. briggsae sequence curation 2. SNP data handling

Basics of Comparative Genomics

Welcome - webinar instructions

Core genome phylogeny of V. anguillarum strains.

Presentation transcript:

Comparative Genomics

Comparative Genomics Phylogeny Orthologs Paralogs WBG name prediction Synteny / Conservation Multiple Alignments EnsEMBL Analysis Pipeline Compara EnsEMBL Releases Website Mirrors WormBook WormBase SAB 2010

(Near) Future – ABM 2008 improved ortholog relationships paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

Orthology updated TreeFam, Inparanoid and OMA updated pipeline to use hcluster and MCoffee added paralog predictions and OMIM to WormBase SAB 2010

(Near) Future – ABM 2008 improved QC on ortholog relationship paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

WormBase Species (unique genes) Plant Parasites Animal / Human Parasites Tier II Tier I Clade V Clade IV Clade III Caenorhabditae 13% 19% 31% 53% 56% C.briggsae C.brenneri C.japonica H.contortus M.hapla C.remanei C.elegans P.pacificus M.incognita M.incognita B.malayi 13% 7% 50% 55% SAB 2010

WBGeneName transfer modified from Tier II WBG-tool adds pseudo-WBG names to GFF3 / Gbrowse hco-eat-4 Haemonchus contortus mha-eat-4 Meloidogyne hapla bma-eat-4 Brugia malayi SAB 2010

WormBase Species II (WGN-names) Plant Parasites Animal / Human Parasites Tier II Tier I Clade V Clade IV Clade III Caenorhabditae 5340 2962 4642 807 1759 C.briggsae C.brenneri C.japonica H.contortus M.hapla C.remanei C.elegans P.pacificus M.incognita M.incognita B.malayi 5302 24191 2696 1449 SAB 2010

(Near) Future – ABM 2008 improved QC on ortholog relationship paralog information add new genesets for new parasitic species unify TreeFam & Compara whole genome alignments with Haemonchus / Brugia / Pristionchus SAB 2010

Pecan intron loss in C.briggsae intron expansion in Pristionchus GBrowse-SYN SAB 2010

EnsEMBL released C.elegans WS200 on main EnsEMBL site released 5 Caenorhabditis on EnsEMBL-Metazoa updated codebase to r57 updated WormBase InterPro pipeline submitted bug reports & patches to ensembl-core / ensembl-compara / ensembl-hive SAB 2010

EnsEMBL Metazoa SAB 2010

Sanger WormBase Mirror WS198 ~1600 visitors / month 8 views / visit mostly from US / UK / Canada SAB 2010

(Near) Future Meloidogyne incognita genes and downstream analysis new Wormbase mirror (bigger, faster & virtualised) Tier III species on EnsEMBL-Metazoa Brugia malayi Haemonchus contortus Meloidogyne hapla Meloidogyne incognita SAB 2010

Acknowledgements CSHL: Sheldon McKay OICR: Todd Harris Norie de la Cruz Abigail Cabunoc Lincoln Stein EBI: Javier Herrero Sanger: Ed Griffith CalTech: Erich Schwartz SAB 2010