(A) SGT Antisense RNA construct

Slides:

Advertisements

Similar presentations

Fig. 4-1, p Fig. 4-2, p. 109 Fig. 4-3, p. 110.

Advertisements

P.464. Table 13-1, p.465 Fig. 13-1, p.466 Fig. 13-2, p.467.

Fig. 11-1, p p. 360 Fig. 11-2, p. 361 Fig. 11-3, p. 361.

Table 6-1, p Fig. 6-1, p. 162 p. 163 Fig. 6-2, p. 164.

The Flavr Savr Tomato November 25, 2014 Lu Tian. Flavr Savr Tomato The first FDA approved genetically modified food Licensed in 1994 Ripening causes production.

University of Oklahoma Genome Center4/14/12.

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.

1kb PpABA1 gene model AtABA1 gene model (a) (b) ATGTAA ATG TAA Fig. S1. Characterization of the PpABA1 gene. (a) AtABA1 and PpABA1 gene models. The PpABA1.

Chapter 11: Functional genomics

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Workpackage 2: Breeding Systems

Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.

Fig. 6-CO, p p. 185a p. 185b p. 185c p. 185d.

a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c

Table A. Sequences used in making CsKASII RNAi constructs

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

The Flavr Savr Tomato.

Additional file 2: Supplementary Figures

Figure 1. Representative mismatched amplification mutation assay polymerase chain reaction amplicons for detection of 16u>c rrs mutation in 14 Mycobacterium.

Quantitative Detection and Differentiation of Human Herpesvirus 6 Subtypes in Bone Marrow Transplant Patients by Using a Single Real-Time Polymerase Chain.

Supplemental Figure 1 A) B) C)

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Fosmid Library Construction Report

Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A by Richard D. Bagnall, Naushin Waseem, Peter M.

Figure S3 Gui kb a TP b Figure S3 Southern hybridization analysis of hygromycin.

Supplementary Figure 1 A B wild type ΔacsS

Fig. S Fig. S2 Cre-mediated recombination in vivo. G2 mice displaying high levels of GFP were crossed.

Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region G. Yang, R. Benson, T.

© 2013 Elsevier, Inc. All rights reserved.

by Martin de Boer, Egbert Bakker, Stefaan Van Lierde, and Dirk Roos

A Squalene Epoxidase Is Involved in Biosynthesis of Both the Antitumor Compound Clavaric Acid and Sterols in the Basidiomycete H. sublateritium Ramiro.

Consequences of T‐DNA insertion on SWP expression in swp mutant.

ADAMTS-5 deficient mice do not develop mechanical allodynia associated with osteoarthritis following medial meniscal destabilization A.M. Malfait, J.

R Kumar, M Mukherjee, M Bhandari, A Kumar, H Sidhu, R.D Mittal

A Novel Alu-Like Element Rearranged in the Dystrophin Gene Causes a Splicing Mutation in a Family with X-Linked Dilated Cardiomyopathy Alessandra Ferlini,

Isolation and characterisation of toxin A-negative, toxin B-positive Clostridium difficile in Dublin, Ireland D. Drudy, N. Harnedy, S. Fanning, R. O'Mahony,

Volume 10, Issue 1, Pages (July 2004)

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

Volume 18, Issue 2, Pages (April 2005)

Volume 11, Issue 19, Pages (October 2001)

Xiuqing Wang, Zhongjie Sun, Robert Cade Kidney International

Fig. 6-CO, p. 211.

Expression of the 11β-hydroxysteroid dehydrogenase 2 gene in the mouse

Expression and localization of histamine H2 receptor messenger RNA in human nasal mucosa Noriko Hirata, MDa, Kazuhiko Takeuchi, MDa, Kotaro Ukai, MDa,

Defining the CREB Regulon

Volume 11, Issue 6, Pages (March 2001)

Karmella A. Haynes, Amy A. Caudy, Lynne Collins, Sarah C.R. Elgin

Frpo: A Novel Single-Stranded DNA Promoter for Transcription and for Primer RNA Synthesis of DNA Replication Hisao Masai, Ken-ichi Arai Cell Volume.

Volume 10, Issue 1, Pages (January 2017)

Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

Assessing the Functional Characteristics of Synonymous and Nonsynonymous Mutation Candidates by Use of Large DNA Constructs A.M. Eeds, D. Mortlock, R.

Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers by Debargh Dutta, Devi Gunasekera,

Characterization of messenger RNA expression of estrogen receptor-α and -β in patients with ovarian endometriosis Sachiko Matsuzaki, M.D., Takao Fukaya,

circRNA prediction, sequence determination, and validation.

Deletion of Srf with a skeletal muscle-specific Cre transgene.

PCR amplification of the ORF encoding the cytosolic p36 protein of M

Sugar Receptors in Drosophila

Genomic structure of LTBP-4 around the 3rd 8-Cys repeat.

MtDNA analysis identifies 8 patients with PS in a cohort of DBA patients. mtDNA analysis identifies 8 patients with PS in a cohort of DBA patients. (A)

Expression of multiple forms of MEL1 gene products.

Association of a polymorphism in the ornithine decarboxylase gene with male androgenetic alopecia Rachel A. Garton, MD, Amy J. McMichael, MD, Joel Sugarman,

Exon Skipping in IVD RNA Processing in Isovaleric Acidemia Caused by Point Mutations in the Coding Region of the IVD Gene Jerry Vockley, Peter K. Rogan,

Keratinocyte-specific disruption of the Stat3 gene by the Cre-LoxP system. Keratinocyte-specific disruption of the Stat3 gene by the Cre-LoxP system. A,

Presentation transcript:

(A) SGT Antisense RNA construct LB loxP ocspA bar 35S Napin RB SGTAS (a) (b) 100bp ladder Binary vector Varuna (host) BjSGTAS.4 BjSGTAS.81 0.9 Kb S3 Fig (A). (a) Map of the SGT Antisense RNA construct indicating the position of the primers (small black arrow) (Primer name: BjNap- F; BjSGTAS-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (899 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

(B) SGT RNAi construct (a) (b) SS AS IN LB loxP ocspA bar 35S Napin RB (b) 100bp ladder Binary vector Varuna (host) BjSGTRNAi.17 BjSGTRNAi.26 0.7 Kb S3 Fig (B). (a) Map of the SGT RNAi indicating the position of the primers (small black arrow) (Primer name: Intron-F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGT RNAi transgene (732 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

(C) SGTamiRNA40 construct LB loxP ocspA bar 35S Napin RB SGTamiRNA 40 (b) 100bp ladder Binary vector Varuna (host) BjSGTamiR40.3 BjSGTamiR40.35 0.7 Kb S3 Fig (C). (a) Map of the SGT amiR40 constructs indicating the position of the primers (small black arrow) (Primer name: BjNap- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (750 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

(D) SCT Antisense RNA construct LB loxP ocspA bar 35S SCTEp RB SCTAS (b) 1.0Kb ladder Binary vector Varuna (host) BjSCTAS.8 BjSCTAS.36 2.0 Kb S3 Fig (D). (a) Map of the SCT Antisense constructs indicating the position of the primers (small black arrow) (Primer name: BjSCT-EP- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (2352 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).

(E) SCTRNAi construct (a) (b) LB loxP ocspA bar 35S SCTEp RB SS AS IN (b) 100bp ladder Binary vector Varuna (host) BjSCTRNAi.1 BjSCTRNAi.36 0.5 Kb S3 Fig (E). (a) Map of the SCT RNAi constructs indicating the position of the primers (small black arrow) (Primer name: BjSCTRNAi-F; BjSCT-In-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (560 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4and 5).

(F) SCTamiRNA 37 construct LB loxP ocspA bar 35S SCTEp RB SCTamiRNA 37 (b) 100bp ladder Binary vector Varuna (host) BjSCTamiR37.56 1.0 Kb S3 Fig (F). (a) Map of the SCT amiR37 constructs indicating the position of the primers (small black arrow) (Primer name: BjSCT-EP- F; OcspA-R; S1 Table) used for the transgene amplification. (b) Amplification of the SGTAS transgene (1122 bp fragment) from the binary vector (Lane 2) and genomic DNA of the two representative T1 transgenics (Lane 4 and 5).