Halfway Feedback (yours)

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

Predicting RNA Structure and Function. Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns mRNA untranslated region (UTR)
Chapter 4 Transcription and Translation. The Central Dogma.
Zhi John Lu, Jason Gloor, and David H. Mathews University of Rochester Medical Center, Rochester, New York Improved RNA Secondary Structure Prediction.
[Bejerano Fall10/11] 1.
[Bejerano Aut07/08] 1 MW 11:00-12:15 in Redwood G19 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.
Cell Protein Production
Ribosome Structure 1. Outline the structure of a ribosome based on the diagram: ● A site.
PROTEIN SYNTHESIS.
Molecular genetics of gene expression Mat Halter and Neal Stewart 2014.
Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.
The Search for Small Regulatory RNA Central Dogma: DNA to RNA to Protein Replication Processing / Translocation hnRNA rRNAtRNA mRNA.
RNA carries DNA’s instructions.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
1 TRANSCRIPTION AND TRANSLATION. 2 Central Dogma of Gene Expression.
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 6:
Predicting protein degradation rates Karen Page. The central dogma DNA RNA protein Transcription Translation The expression of genetic information stored.
PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.
12.3 DNA, RNA, and Protein Objective: 6(C) Explain the purpose and process of transcription and translation using models of DNA and RNA.
Progress toward Predicting Viral RNA Structure from Sequence: How Parallel Computing can Help Solve the RNA Folding Problem Susan J. Schroeder University.
Questions?. Novel ncRNAs are abundant: Ex: miRNAs miRNAs were the second major story in 2001 (after the genome). Subsequently, many other non-coding genes.
[BejeranoFall15/16] 1 MW 1:30-2:50pm in Clark S361* (behind Peet’s) Profs: Serafim Batzoglou & Gill Bejerano CAs: Karthik Jagadeesh.
Motif Search and RNA Structure Prediction Lesson 9.
PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.
Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.
SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.
Biochemistry Free For All
Transcription and Translation
RNA carries DNA’s instructions.
CENTRAL DOGMA OF BIOLOGY
Transcription and Translation
CS273A Lecture 3: Non Coding Genes MW 12:50-2:05pm in Beckman B100
Ch 10: Protein Synthesis DNA to RNA to Proteins
Chapter 15: RNA Ribonucleic Acid.
From DNA to Proteins Transcription.
Protein Synthesis.
From Gene to Protein Chapter 2 and 7 of IB Bio book.
Predicting RNA Structure and Function
The making of proteins for …..
RNA Secondary Structure Prediction
RNA carries DNA’s instructions.
RNA carries DNA’s instructions.
12-3 RNA and Protein Synthesis
SBI 4U: Metablic Processes
RNA carries DNA’s instructions.
Synthetic Biology: Protein Synthesis
PROTEIN SYNTHESIS THE DETAILS.
Protein Synthesis Lecture 5
Cell Protein Production
Translation.
Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger
Transcription and Translation
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
12-3 RNA and Protein Synthesis
How genes on a chromosome determine what proteins to make
Transcription and Translation
Noncoding RNA roles in Gene Expression
Genetics Lesson 3.
Unit 1: 1.5 Structure of the Genome
RNA carries DNA’s instructions.
credit: modification of work by NIH
Continuation: translation
Genes and Protein Synthesis Review
LAST UNIT! Energetics.
Chapter 15: RNA Ribonucleic Acid.
4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.
Dr. Israa ayoub alwan Lec -6-
Presentation transcript:

http://cs273a.stanford.edu [Bejerano Fall09/10]

Halfway Feedback (yours) Lecture 11 HW1 Feedback (ours) Upcoming Project Non-Coding RNAs Halfway Feedback (yours) http://cs273a.stanford.edu [Bejerano Fall09/10]

Upcoming Project Project will be in groups of 3-4. We will be assigning you into groups. Overlap with CS229 (Machine Learning): How many people take both classes? Are interested in combining projects? http://cs273a.stanford.edu [Bejerano Fall09/10]

Structural RNAs http://cs273a.stanford.edu [Bejerano Fall09/10]

Central Dogma of Biology:

RNA is an Active Player:

What is ncRNA? Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein. Known roles for ncRNAs: RNA catalyzes excision/ligation in introns. RNA catalyzes the maturation of tRNA. RNA catalyzes peptide bond formation. RNA is a required subunit in telomerase. RNA plays roles in immunity and development (RNAi). RNA plays a role in dosage compensation. RNA plays a role in carbon storage. RNA is a major subunit in the SRP, which is important in protein trafficking. RNA guides RNA modification. In the beginning it is thought there was an RNA World, where RNA was both the information carrier and active molecule.

RNA Folds into (Secondary and) 3D Structures AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA We would like to predict them from sequence. Waring & Davies. (1984) Gene 28: 277. Cate, et al. (Cech & Doudna). (1996) Science 273:1678.

Nearest Neighbor Model for RNA Secondary Structure Free Energy at 37 OC: Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287. http://cs273a.stanford.edu [Bejerano Fall09/10]

RNA structure: Basics Key: RNA is single-stranded. Think of a string over 4 letters, AC,G, and U. The complementary bases form pairs. Base-pairing defines a secondary structure. The base-pairing is usually non-crossing. Bafna

Energy Landscape of Real & Inferred Structures http://cs273a.stanford.edu [Bejerano Fall09/10]

Unfortunately… Random DNA (with high GC content) often folds into low-energy structures. What other signals determine non-coding genes?

Evolution to the Rescue http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

RNA sequence analysis - SCFGs MP A – U G – C A G MP MP ML ML ML G G A A G A U C C < < < . . . > > >

http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

MicroRNA http://cs273a.stanford.edu [Bejerano Fall09/10]

Genomic context known miRNAs in human intergenic intronic polycistronic monocistronic

Example: tRNA Bafna

http://cs273a.stanford.edu [Bejerano Fall09/10]

RNA structure: pseudoknots Sometimes, unpaired bases in loops form ‘crossing pairs’. These are pseudoknots. Bafna

http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

Human Specific Rapid Evolution maximally changed r m h r m c h 100%id near 100%id http://cs273a.stanford.edu [Bejerano Fall09/10]

Human accelerated http://cs273a.stanford.edu [Bejerano Fall09/10]

Other Non Coding Transcripts http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

mRNA http://cs273a.stanford.edu [Bejerano Fall09/10]

EST http://cs273a.stanford.edu [Bejerano Fall09/10]

X chromosome inactivation in mammals Dosage compensation X X X Y

Xist – X inactive-specific transcript Avner and Heard, Nat. Rev. Genetics 2001 2(1):59-67

Microarrays, Next Gen(eration) Sequencing etc. http://cs273a.stanford.edu [Bejerano Fall09/10]

End Results http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

http://cs273a.stanford.edu [Bejerano Fall09/10]

Transcripts, transcripts everywhere Human Genome Transcribed (Tx) Leaky tx? Functional? Tx from both strands http://cs273a.stanford.edu [Bejerano Fall09/10]

Halfway Feedback http://cs273a.stanford.edu [Bejerano Fall09/10]