Synthetic Biology Sergio Peisajovich Lim Lab June 2007

What is Synthetic Biology? It is an emerging field of biology that aims at designing and building novel biological systems. The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.

Why do we need it? “What I cannot create, I do not understand.” Synthetic Biology Why do we need it? “What I cannot create, I do not understand.” - Richard Feynman

Cells are the ultimate Chemical Factory. Synthetic Biology Why do we need it? Cells are the ultimate Chemical Factory.

1- Biology is hierarchical Synthetic Biology Is it achievable? 1- Biology is hierarchical

Synthetic Biology Is it achievable? 2- Biology is Modular

Synthetic Biology Is it achievable? Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.

A possible hierarchy for synthetic biology

Biological Components: 1-Parts Synthetic Biology Biological Components: 1-Parts

Biological Components: 2-Devices Synthetic Biology Biological Components: 2-Devices

Biological Components: 3-Systems or Modules Synthetic Biology Biological Components: 3-Systems or Modules

Biological Components: 3-Systems or Modules Synthetic Biology Biological Components: 3-Systems or Modules Basu et al (2005) Nature, 434: 1130-4)

Biological Components: 3-Systems or Modules Synthetic Biology Biological Components: 3-Systems or Modules

Biological Components: 3-Systems or Modules Synthetic Biology Biological Components: 3-Systems or Modules

Synthetic Biology as Engineering For synthetic biology to become a form of engineering it will be necessary to achieve precision and reliability. Factors preventing this: 1- Incomplete knowledge of biology. 2- Inherent functional overlap (parts with many -some unknown- functions, some of which are detrimental to the goal in mind. 3- Incompatibility between parts. 4- Parts functionality depends on context. 2- CI represses expression of unrelated host genes 3- LuxR interacts with CI and blocks its function 4- GFP is non-fluorescent in host

Synthetic Biology as Engineering Standard Parts Parts should not have multiple functions (One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin) Parts should not encode multiple functions

Synthetic Biology as Engineering Standard Parts Different parts should be compatible Parts should work in different contexts

Synthetic Biology as Engineering Standard Parts Standardized parts could be easily exchanged between different devices (as well as between different laboratories)

Synthetic Biology as Engineering Abstraction Systems Devices Parts DNA TGCATGCTGATATACGGCTCGAT

Synthetic Biology