Mistakes in the code.

Slides:



Advertisements
Similar presentations
DNA (Gene) Mutations.
Advertisements

How is the amino acid sequence determined?
HAPPY TUESDAY Bellwork: Study the Central Dogma, Transcription, & Translation. On Bellwork sheet write “Study for Quiz”.
DNA MUTATIONS.
Mutations Mutation- a change in the DNA nucleotide sequence
RNA and Protein Synthesis
Mutations (12.4) State Standard
BELL WORK: You have five minutes to finish yesterday’s worksheets and turn them in.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Mistakes can occur in any process. When do mistakes have stronger effects – When making a DNA? Making mRNA? Making a protein? Explain why. (Same as saying.
Mistakes in the code. Review: What does DNA look like? How is DNA made? How does DNA instruct the cell to make proteins? What determines the order of.
Welcome 1/26-27/16  In your journal, write a paragraph explain what a genetic code is and the purpose of transcription and translation.  Turn in Snork.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.
13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.
Mistakes in the code. Review: What does DNA look like? How is DNA for a new cell made? How does DNA instruct the cell to make proteins? What determines.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Biology Review Benchmark Test #3
Learning Target: (haven’t used)
Genetic code and mutations
12.4 Assessment Answers.
Life’s Instruction Manual or What Genes are Made Of
Protein Synthesis.
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Mutation Notes Chapter 12-4.
11.3 Mutations.
DNA MUTATIONS.
Mutations (12.4) State Standard
Mutations.
DNA Replication.
Mutations.
Mutations.
Copyright Pearson Prentice Hall
Gene Mutations.
MUTATIONS.
Mutations.
Mutations.
Mutations.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
Sickle Shaped Red Blood Cells
I can… Agenda Index Card Question HW Review Translation Notes
Day 4 Aim: DNA and Mutations
Mutations 5.4.
To be successful today…
Mutations.
Mutations.
MONDAY DO NOW Assign Yourself – Homework Packet Due THU 10/20 Biorganizer – Cornell Notes page 50 Title: TYPES OF MUTATIONS DO NOW: TRANSLATION DO NOW.
Chapter 11.6 When it all goes Wrong
Life’s Instruction Manual or What Genes are Made Of
Distinguish between codon and anticodon.
Lesson Overview 13.3 Mutations Objectives:
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations changes in genetic material (_____).
DO NOW Hand in the DNA vs RNA Paper Model Lab – everyone must hand in the questions, be sure both partners’ names are on the models! Take the Amoeba Sisters.
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Read the lab handout COMPLETELY
13.3 Mutations.
Mutations.
Lesson Overview 13.3 Mutations.
Mutations.
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Genetic Mutations.
Presentation transcript:

Mistakes in the code

Review: What are some features of DNA? How is DNA for a new cell made? How does DNA instruct the cell to make proteins (The Central Dogma of biology)? What determines the order of amino acids in a protein? What happens if you change an amino acid in the sequence of a particular protein? Why?

How does your DNA determine your traits? mRNA protein Observed trait transcription translation protein function ( ex. enzyme activity) Remember: Traits are determined by the functions of proteins Protein function is determined by protein shape Protein shape is determined by amino acid sequence Amino acid sequence is determined by nucleotide sequence

Questions Q. We’ve studied transcription, translation, and replication. A mistake in which of these processes would result in a permanent mutation? Mitosis and Meiosis are about replicating the DNA in somatic and sex cells. Mistakes in these processes can cause permanent changes in the DNA. Can you inherit mistakes from Mitosis? Meiosis?

Mistakes can be inherited If a DNA mistake in sperm or egg cell production is not corrected, the new sequence of DNA is passed on to offspring. Over generations, mutations accumulate and species can slowly change their appearance.

Mutations Mutation- a change in the DNA nucleotide sequence Mutations can be silent (have no/neutral effect) Cause subtle differences (both harmful & beneficial) Cause dramatic effects on observed traits in individuals (Usually harmful)

Mutations can change the amino acid sequences of proteins DNA sequence: T A C C G A G A T T C A mRNA sequence: A U G G C U C U A A G U amino acid sequence: Met -- Ala -- Leu -- Ser mRNA sequence: A U G G C U A U A A G U amino acid sequence: Met -- Ala -- Iso -- Ser T

How does this mutation change the amino acid sequence? (Original) DNA sequence: A A T G C A T A T G C A mRNA sequence: U U A C G U A U A C G U amino acid sequence: Leu -- Arg -- Ile -- Arg (Mutated) DNA sequence: A A T T C A T A T G C A mRNA sequence: U U A A G U A U A C G U amino acid sequence: Leu -- Ser -- Ile -- Arg

3 types of mutations T Point or Substitution Insertion Deletion T A C C G A G A T T C A Substituting one nucleotide for another. T A C C G A T G A T T C A Inserting one or more nucleotides T A C C G A G A T T C A Deleting one or more nucleotides

Consequences of mutations… As a result of mutations, differences exist between within a species DNA sequence!

How much variation in DNA exists between 2 people? About 1 in every 1,000 nucleotides is different between 2 people (0.1% difference means 99.9% identical) We have about 3 billion nucleotides in all, so that means there are about 3 million nucleotide differences between 2 people

Example of a point mutation that exists between 2 people? Hemoglobin (beta) gene sequence from person A

Example of a point mutation that exists between 2 people? Hemoglobin (beta) gene sequence from person B

Frameshift mutations One or more than one nucleotide can be added or deleted with insertion and deletion mutations. If the number of nucleotides is not a multiple of 3, it is called a frameshift mutation. Why do we call this a frameshift mutation? Can substitution mutations cause frameshifts? Explain why or why not. Students discuss in partners/small group Discuss briefly as class Students write answers INDIVIDUALLY (no talking answers to question on notecard and pass in for assessment)

What is the observed effect of mutations? No Effect (think about it: are there 3 million differences between 2 people?) Why? Some mutations code for the same amino acid Most mutations are in sequences of DNA between genes. https://www.youtube.com/watch?v=ZvnhZI-GZS4 Variation – For any trait in a population there is variation within that trait as a result of small sequence differences (DNA Amino Acids)

Genetic diseases Most changes are harmless, but some can cause specific diseases. One way to determine whether a disease is inheritable is to trace the family history of a disease by creating a type of family tree called a pedigree. One inheritable disease caused by a specific substitution (or “point”) mutation is sickle cell anemia.

Your Turn Complete the “Mutations practice” worksheet. You will learn how some mutations can affect the amino acid sequence of proteins Consider how severe of an effect each mutation would have on the ability of the protein to function.

Questions Which type of mutations had the biggest effect on the protein sequence? WHY? Which type of mutations had the smallest effect on the protein sequence? WHY? Which examples would you predict to have the biggest effects on a trait? WHY? Which examples would you predict to have the smallest effects on a trait? WHY? What is a possible explanation for the occurrence of these mutations?