8 Microbial Genetics.

Slides:



Advertisements
Similar presentations
Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings PowerPoint ® Lecture Slide Presentation prepared by Christine L. Case Microbiology.
Advertisements

Chapter 22 Nucleic Acids and Protein Synthesis
The how and why of information flow in living things.
Microbial Genetics. Terminology Genetics Genetics Study of what genes are Study of what genes are how they carry information how they carry information.
Copyright © 2006 Pearson Education, Inc., publishing as Benjamin Cummings Translation  mRNA is translated in codons (three nucleotides)  Translation.
Medical Technology Department, Faculty of Science, Islamic University-Gaza MB M ICRO B IOLOGY Dr. Abdelraouf A. Elmanama Ph. D Microbiology 2008 Chapter.
Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings PowerPoint ® Lecture Slide Presentation prepared by Christine L. Case Microbiology.
Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue
+ Bacterial Genetics March Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how.
Transcription.
Making of Proteins: Transcription and Translation
Copyright © 2010 Pearson Education, Inc. Lectures prepared by Christine L. Case Chapter 8 Microbial Genetics.
Chapter 8 Microbial Genetics.
Microbial Genetics: DNA Replication Gene Expression
DNA Basics. Organisms are made up of cells The nucleus of the cell contains DNA.
Copyright © 2006 Pearson Education, Inc., publishing as Benjamin Cummings M I C R O B I O L O G Y a n i n t r o d u c t i o n ninth edition TORTORA  FUNKE.
Chapter 5 Microbial Genetics. Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated.
Chapter 8, part A Microbial Genetics.
Centra Dogma Primer. Structure of DNA and RNA Nucleic acids made of nucleotides G, A, T/U, C Ribose vs. deoxyribose Template-dependent synthesis Double.
Protein Synthesis Process that makes proteins
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
Protein Synthesis Chapter Protein synthesis- the production of proteins The amount and kind of proteins produced in a cell determine the structure.
Chapter 8: Microbial Genetics
Microbial Genetics - DNA Transfer l Review of Information Transfer in Cell l Recombination l Transfer of DNA &Genetic Recombination in Bacteria –Conjugation.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
The Genetic Code and Translation. Codon – three mRNA bases in a row that code for an amino acid Divide this mRNA strand into codons: AUGGGCACUCUCGCAUGA.
12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.
The Genetic Code Objective: F2 - Explain … process of transcription & translation …, describe the role of DNA & RNA during protein synthesis, & recognize.
Regulation of Bacterial Gene Expression Constitutive enzymes are expressed at a fixed rate. Other enzymes are expressed only as needed. –Repressible enzymes.
Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 
Copyright © 2010 Pearson Education, Inc. MICROBIAL GENETICS Chapter 8.
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Microbiology B.E Pruitt & Jane J. Stein AN INTRODUCTION EIGHTH EDITION TORTORA FUNKE CASE Chapter 8, part B Microbial Genetics.
Protein Synthesis. One Gene – One Enzyme Protein Synthesis.
Chapter 8, part B Microbial Genetics.
Chapter 8, part B Microbial Genetics.
Ribosomes and Protein Synthesis
Protein Synthesis- Translation
CHAPTER 8 MICROBIAL GENETICS: BIO 244 MICROBIOLOGY
Gene Expression Continued
Protein Synthesis.
MICROBIOLOGY LECTURES
Tuesday NOTES: Translation.
Central Dogma.
Bacterial Genetics Ch. 18.
OUTLINE 3 Control of Gene Expression in Prokaryotes
Transcription and Translation
Protein Synthesis: Translation
Daily Warm-Up Dec. 12th Transcribe this DNA segment
Amino Acid Activation And Translation.
Chapter 8, part A Microbial Genetics.
Translation -The main purpose of translation is to create proteins from mRNA  -mRNA serves as a template during protein synthesis -this means that, ultimately,
Protein Synthesis: Transcription
Protein Synthesis Using DNA to Make Proteins
Protein Synthesis RNA.
Central Dogma
Protein Synthesis.
Unit 7: Molecular Genetics
Protein Synthesis.
Unit 7: Molecular Genetics
GENE EXPRESSION / PROTEIN SYNTHESIS
Ch Protein Synthesis Protein Synthesis Proteins are polypeptides
Translation: Protein Synthesis
Transcription Using DNA to make RNA.
Chapter 8, part A Microbial Genetics.
Protein Synthesis.
Chapter 8, part B Microbial Genetics.
DNA & Translation.
Presentation transcript:

8 Microbial Genetics

Translation mRNA is translated in codons (three nucleotides) Translation of mRNA begins at the start codon: AUG Translation ends at a stop codon: UAA, UAG, UGA PLAY Animation: Translation Figure 8.2

Translation Figure 8.8

Translation Figure 8.10

Translation Figure 8.9, step 1

Translation Figure 8.9, step 2

Translation Figure 8.9, step 3

Translation Figure 8.9, step 4

Translation Figure 8.9, step 5

Translation Figure 8.9, step 6

Translation Figure 8.9, step 7

Translation Figure 8.9, step 8

Regulation of Bacterial Gene Expression Constitutive enzymes are expressed at a fixed rate. Other enzymes are expressed only as needed. Repressible enzymes Inducible enzymes

Operon PLAY Animation: Operons Figure 8.12, step 1

Induction Figure 8.12, step 2a

Induction Figure 8.12, step 3a

Repression Figure 8.12, step 2b

Repression Figure 8.12, step 3b

Regulation of Gene Expression Figure 8.13