Whole transcriptome sequencing reveals photoreceptors mRNA expression in nocturnal cutlass fish during the midnight Ji-Yeon Hyeon1, Jun-Hwan Byun1, Seong-Rip Oh2, Mun-Kwan Kim2, Su-Hyun Park2, Sung-Pyo Hur1 and Hyeong-Cheol Kang2* 1Jeju International Marine Science Research & Logistics Center, Korea Institute of Ocean Science & Technology 2Ocean and Fisheries Researches Institute, Jeju Special Self-Governing Provence Introduction The opsin family are the universal photoreceptor molecules of all visual systems in the vertebrates including teleost. They can change their conformation from a resting state to a signaling state upon light absorption, which activates the G-protein coupled receptor, thereby resulting in a signaling cascade that produces physiological responses. However, the species is poorly characterized at molecular level with little sequence information available in public databases. Materials and Method Results Table 1. Primer set for full-length cloning Cutlass fish, Trichiurus lepturus Gene Primer Sequences Sequence RH1 GSP1 5’- TCCAGGTGAAGACCAAGCCCATGAT -3’ VA opsin 5’- ACAGTGGCTGTCTTGGAAAAGAACG -3’ NGSP1 5’- AGGTGAAGACCAAGCCCATGATCGC -3’ 5’- GTGGCTGTCTTGGAAAAGAACGCGG -3’ GSP2 5’- CTGTGGTCACTGGTCGTTCTGGCTA -3’ 5’- TGGTGATGATCGTGGCGTTCATGGT -3’ NGSP2 5’- TGGTCACTGGTCGTTCTGGCTATTG -3’ 5’- TGATGATCGTGGCGTTCATGGTGTG -3’ RH2 5’- CCAACTGTGCTGAGCATGCAGTTAC -3’ Peropsin 5’- CATCTTGGTGACGTCCATCTGGTCC -3’ 5’- ACTGTGCTGAGCATGCAGTTACGGA -3’ 5’- CTTGGTGACGTCCATCTGGTCCGAC -3’ 5’- TCCTGATGGTGCTTGGCTTCCTGGT -3’ 5’- GCGGTGATTGCCGTGAACTTCGTGG -3’ 5’- TGATGGTGCTTGGCTTCCTGGTAGC -3’ 5’- GTGATTGCCGTGAACTTCGTGGTGC -3’ Opn3 5’- GGCGCTCTTTGAGAGTTTGCTGCAG -3’ Melanopsin-A 5’- ATGCCCAGCCCAGGAAATCAGTGTG -3’ 5’- GCTCTTTGAGAGTTTGCTGCAGACA -3’ 5’- CCCAGCCCAGGAAATCAGTGTGACA -3’ 5’- TCTCTCCCACAATGGCCATCATCCC -3’ 5’- GGTACAACGGCTGGGAACTCAGGTG -3’ 5’- CTCCCACAATGGCCATCATCCCCTC -3’ Table 3. The deduced photoreceptors sequence of cutlass fish. Collected at nighttime Photoreceptors Nucleotide sequence (bp) Amino acid sequence (aa) RH1 1668 354 RH2 2036 355 Opn3 1790 385 Peropsin 1400 461 VA opsin 3187 381 Melanopsin-A 3557 400 B.W.: 71.0 ~131.0 g B.L.: 61.5 ~69.0 cm Table 2. Primer set for in mRNA expressions Gene Primer Sequences EF1α Forward 5’- TCACCCTGGGAGTAAAGCAG -3’ Reverse 5’- TCCATCCCTTGAACCAGGAC -3’ RH1 5’- GGTGAAGACCAAGCCCATGA -3’ 5’- GTGATTCTCGGTGAAGCGGA -3’ RH2 5’- CTGGTGGTCACAGCTCAGAA -3’ 5’- GGACTCCAATTCCTGCATGT -3’ Opn3 5’- GCTTCTGCAACAACGTCGTT -3’ 5’- GTAGCGCTCATAGGCCAGAG -3’ VA opsin 5’- AGACTCGCGCCTTGTAAACA -3’ 5’- AGGCTACTTGCTTGGCTGAG -3’ Per 5’- GGCTGGATACCTCATCACCG -3’ 5’- GTGAGGTAGCGGTCTATGGC -3’ Melanopsin-A 5’- TGGAGCTCGTACATCCCTGA -3’ 5’- TCGCCAACTTCCACTCACTC -3’ Figure 3. Distribution of RH1, RH2, Opn3, VAopsin, Peropsin and Melanopsin-A mRNA expressions in the organ and tissue of cutlass fish, Thunnus orientalis. Organ and tissue samples (n= 13) were collected from the fish. They were analyzed with RT–PCR. The expression of Elongation factor 1-alpha (EF1a) mRNA was used as reference. Samples without cDNA templates were loaded as negative control. Marker; 100 bp DNA ladder. Figure 2. Comparison of the predicted amino acid sequences of Melanopsin-A, Peropsin, Opn3, VA opsin, RH1 and RH2. The seven transmembrane domains are labeled TM1 to TM7 above the sequence. Figure 1. Phylogenetic tree of opsins including .One thousand bootstrap repetitions were performed, and values are shown at the inner nodes. The scale bar is calibrated in substitutions per site. Figure 4. Histological observation of retina layer in Trichiurus lepturus (A), Paralichthys olivaceus (B), Pagrus maior (C). Conclusion and Discussion The cutlass fish opsin genes contained the seven presumed transmembrane domains that are characteristic of the G-protein-coupled receptor family. However, middle wavelength sensitive pigment (MWS) long wavelength sensitive pigment (LWS) were not detected in this species. RT-PCR revealed that cutlass fish all of opsin genes was detected in retina, while rodopsin2 mRNA were detected only in the retina. The levels of rhodopsin1 mRNA were high expressed than other opsin genes during the nighttime. These results suggested that retina and rhodopsin1 (498nm) may play important role in detecting light and produces physiological responses.