Cell and Tissue Research * Ep n PM L a 20 m b sc n Bl m 5 m Sup. Fig 1 - Histological section (A) stained with HE and TEM (B) of the midgut of three-days old 4th larvae of PPIS. A - Epithelium (Ep) with the digestive columnar cells with central nuclei (n). Note protrusion (bleb) of the apical cytoplasm (*) towards the midgut lumen. Peritrophic matrix (PM) separates the luminal content (L) from the epithelium. B - Two stem cells (sc) close to the basal lamina (Bl) in the midgut epithelium. In one of the cells a prominent and central nucleus (n) and few mitochondria (m) are seen. Midgut morphological changes and autophagy during metamorphosis in sand flies   Juliana Malta, Matthew Heerman, Ju Lin Weng, Kenner M. Fernandes, Gustavo Ferreira Martins, Marcelo Ramalho-Ortigão Cell and Tissue Research

a Height of the Cells c b d

Cell and Tissue Research Sup. Fig. 2 - Height of the digestive cells of LLJB and PPIS (a) and midgut length and width during developmental stages in LLJB (B-D). Length and width of the midgut in 3rd instar (L3), 4th instar (L4), pupa, and adult were measured for five insects at each stage of development. [a] Midgut cell height (mean ± SE). Asterisks indicate statistically significant difference between the two species at the same developmental stage by T student test (p<0.001). Lower (LLJB) and upper (PPIS) case letters indicate whether differences in digestive cell height are statistically significant (ANOVA/Tukey) (p<0.001). [b] Average length and standard deviation of insects in each stage. [c] Change in average width across stages. One way ANOVA was performed with a Tukey post test for multiple comparisons to measure statistical significance (P<0.05). [d] Axial ratio (L/W) of the midgut in L3, L4, pupa, and adult. This calculation was based on the length of the midgut divided by the average width of the midgut across its length. One way ANOVA was performed with a Tukey post test for multiple comparisons for significance (p<0.05). Midgut morphological changes and autophagy during metamorphosis in sand flies   Juliana Malta, Matthew Heerman, Ju Lin Weng, Kenner M. Fernandes, Gustavo Ferreira Martins, Marcelo Ramalho-Ortigão Cell and Tissue Research

a b d c e f au L rer b n n Ep n ef Ep n L ml L Ep mv Ep L n nu n b A

Cell and Tissue Research Sup. Fig. 3 - Histological sections (A and C-E; stained with HE) and TEM (C and F) of the midgut of LLJB and PPIS. [a] Midgut epithelium (Ep) of L4-5 of LLJB with digestive cells with a central nucleus, evident nucleolus (nu) and brush border (b). L - midgut lumen. [b] Portions of two digestive cells of L4-5 PPIS, showing part of their nuclei (n) with a predominance of decondensed chromatin. au - autophagic vacuoles; rer - rough endoplasmic reticulum. [c] Midgut epithelium (Ep) with digestive columnar cells of pre-pupa of LLJB, with central nuclei (n). Arrows - stem cells on the basal region of the epithelium. L - lumen; ml - muscle layer. [d] Midgut epithelium (Ep) of LLJB 72h after pupation onset (P72) with flattened cells. L - strongly stained lumen; n - nucleus. [e] Midgut epithelium (Ep) of adult with columnar digestive cells, with a central nucleus (n) and brush border (b). L - lumen. [f] Digestive cell of LLJB adult with central nucleus (n) with predominant decondensed chromatin and microvilli (mv) arranged in parallel in the apical region. Midgut morphological changes and autophagy during metamorphosis in sand flies   Juliana Malta, Matthew Heerman, Ju Lin Weng, Kenner M. Fernandes, Gustavo Ferreira Martins, Marcelo Ramalho-Ortigão Cell and Tissue Research

Accesion # D. melanogaster Accesion # L. longipalpis   Sup. Tab. 1 - Summary of Blast data used to locate L. longipalpis autophagy and growth factor sequences. The D. melanogaster query accession numbers and corresponding subject L. longipalpis accession numbers are listed along with the % identity, score, and E-values. Gene Symbol Accesion # D. melanogaster Accesion # L. longipalpis Identity Score E-value ATG1 NP_648601.1 LLOJ007855 79.70% 1431 4.00E-157 ATG6 NP_651209.1 LLOJ007047 59.30% 1907 ATG8 NP_727447.1 LLOJ007649 96.60% 814 3.00E-80 Vein NP_523942.2 LLOJ001534 61% 933 1.00E-84 Sup. Tab. 2 - List of forward and reverse primer sequences used for RT-qPCR. Gene Symbol Primer 5' - 3' Forward Primer 5'-3' Reverse ATG1 GGTGATTTGGCGGACTAC ATTCTGTGGCTTGAGGTC ATG6 GCTCCTGTTGATTGGTCA CGTAAGGGACGAGTTTGTAG ATG8 GAAGTACCTTGTGCCGTCT CAGAGATCCCATTGATGC Vein CGCAATGGATGAGAACAC TGAGCAATACCTACGCTGAC Midgut morphological changes and autophagy during metamorphosis in sand flies   Juliana Malta, Matthew Heerman, Ju Lin Weng, Kenner M. Fernandes, Gustavo Ferreira Martins, Marcelo Ramalho-Ortigão Cell and Tissue Research 50 µm