Protein Processing in the Endoplasmic Reticulum

Slides:



Advertisements
Similar presentations
Protein sorting and the Golgi apparatus
Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Molecular Chaperones The Hsp70 Super-family. Pathways For Protein Folding.
The Unfolded Protein Response in C. Elegans Biology 314, Advanced Cell Biology, Spring 2004.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 7 - Intracellular compartments and transport II
Posttranslational modification, folding, assembly, and death 1.Covalent modifications 1)Proteolytic processing: posttranslational processing is called.
The Secretory Pathway - Classic Experiments - ER Translocation - Membrane budding and fusion.
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
The Endoplasmic Reticulum (ER) Jill, Edward, and Nicole.
How do proteins fold? Folding in a test-tube The structure of proteins is determined by the amino acid sequence; many proteins in solution can be unfolded.
Chapter 3 Membrane targeting of proteins By D. Thomas Rutkowski & Vishwanath R. Lingappa.
Protein Processing in the Endoplasmic Reticulum Phyllis Hanson Cell Biology Dept., Cancer Res Bldg /8/15.
Last Class: 1. Posttranscription regulation
© 2003 By Default!Slide 1 Protein Sorting, Transport and modification part1 M. Saifur Rohman, MD, PhD, FIHA.
Fates of Proteins in Cells See also pages in Goodman.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Gene regulation Lecture No 5: Protein folding and Ubiquitination
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
ENDOPLASMIC RETICULUM Submitted by Dr Madhurima Sharma.
Vesicular Trafficking Movement From the ER Through the Golgi.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
Why organelles? Specialized structures specialized functions cilia or flagella for locomotion Containers partition cell into compartments create different.
Protein Localization Chapter Introduction Figure 10.1.
glycosylation is a non-template derived phenomenon
Intracellular Compartments and Protein Sorting
Membrane Structure & Function
Endomembrane system and vesicular transport
Protein Synthesis and Sorting: A Molecular View
Cells and Tissues.
Protein Sorting & Transport
Vesicular Trafficking
Intracellular Vesicular Traffic
The Endomembrane system
Course in Molecular Biology
Cellular and Molecular Mechanisms of Liver Injury
Modified tRNAs allowed isolation (cross-linking approach) and analysis (fluorescence quenching ) of translocation channel.
Intracellular Vesicular Traffic
Intracellular Compartments and Transport 2
Volume 52, Issue 3, Pages (March 2010)
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
Liver – master and servant of serum proteome
Cellular and Molecular Mechanisms of Liver Injury
Signaling at the Surface
In multicellular organisms
Endoplasmic reticulum stress in liver disease
Figure 1 ER stress and associated lines of defence
Intracellular Compartments and Transport
#24 The Role of Ribosomes, Golgi Apparatus and Endoplasmic Reticulum in the Production, Storage and Secretion of Proteins. Cell Biology Standard 1E. The.
Proteostasis in the endoplasmic reticulum (ER).
Cystic Fibrosis as a Disease of Misprocessing of the Cystic Fibrosis Transmembrane Conductance Regulator Glycoprotein  John R. Riordan  The American Journal.
Alexander Buchberger, Bernd Bukau, Thomas Sommer  Molecular Cell 
Protein Translocons Cell
André Zapun, Claude A Jakob, David Y Thomas, John JM Bergeron 
Chapter 13 Intracellular Vesicular Traffic.
N-glycan processing in the CNX cycle.
Volume 57, Issue 3, Pages (March 2000)
Guardians of the ERAD Galaxy
Tatiana Soldà, Carmela Galli, Randal J. Kaufman, Maurizio Molinari 
UPR and cross-talk between apoptosis and metabolism.
Novel pharmacological strategies to treat cystic fibrosis
Presentation transcript:

Protein Processing in the Endoplasmic Reticulum Phyllis Hanson Cell Biology Dept., Cancer Res Bldg 4625 phanson22@wustl.edu

Outline ER morphology Protein folding What happens when protein folding fails ERAD UPR What happens when protein folding is successful ER exit via COPII vesicles - Retrieval of ER residents from Golgi

Endoplasmic reticulum

] Subdomains of the ER Rough ER (mostly ER sheets or cisternae) Protein translocation Protein folding and oligomerization Carbohydrate addition ER degradation Smooth ER (mostly ER tubules) Lipid metabolism Calcium release Detoxification ER exit sites (a.k.a. transitional ER) - export of proteins and lipids into the secretory pathway, marked by COPII coat ER contact zones - transport of lipids, contact with other organelles Nuclear envelope Nuclear pores Chromatin anchoring ] About 1/3 of cellular protein transits through the ER

ER subdomains as defined by proximity To other structures Examples from cells expressing fluorescently tagged organelle markers Voeltz lab, UC Boulder

Protein Processing and Quality Control in the Endoplasmic Reticulum Posttranslational modifications Protein folding Unfolded Native ERAD: ER-associated degradation Unfolded protein response Exit from the ER

Protein Modifications and Folding in the ER Folding challenging in setting of ~400 mg/ml protein concentration Folding facilitated and monitored by chaperones, both classical (Hsp70/Hsp90) and glycosylation dependent Folded structure can be stabilized by disulfide bonds, facilitated by protein disulfide isomerases Final folding can require assembly of multimeric protein complexes

Role of classical chaperones in ER protein folding ER contains abundant Hsp70 and Hsp90 chaperones Chaperones help other proteins acquire native conformation, but do not form stable complex Hsp70s & Hsp90s bind exposed hydrophobic segments Hsp70 in ER is BiP, interactions with client proteins regulated by ATP hydrolysis and exchange, large variety of cofactors control these GRP94 is main ER Hsp90, also regulated by ATP status PPIases–role of prolyl peptidyl cis-trans isomerases

Role of glycosylation dependent chaperones in ER folding N-linked glycosylation: Asn - X - Ser/Thr Oligosaccharide addition containing a total of 14 sugars En bloc addition to protein; subsequent trimming and additions as protein progresses through the secretory pathway; five core residues are retained in all glycoproteins

Fate of newly synthesized glycoproteins in the ER I Increases solubility Path when nascent protein folds efficiently (green arrows) Players OST = oligosaccharyl transferase GI, GII = glucosidase I and II Cnx/Crt = Calnexin and Calreticulin, lectin chaperones ERp57 = oxidoreductase ERMan1 = ER mannosidase 1 ERGIC53, ERGL, VIP36 = lectins that facilitate ER exit glucose mannose

Domain structure and interactions of calnexin Model showing interaction of a folding glycoprotein with calnexin and ERp57 Calnexin binds other proteins binds sugar Williams, 2006 J Cell Sci 119:615

Fate of newly synthesized glycoproteins in the ER II Path when nascent protein goes through folding intermediates (orange arrows) Players UGT1 (a.k.a. UGGT) = UDP-glucose–glycoprotein glucosyltransferase, recognizes “nearly native” proteins, acting as conformational sensor Reglucosylated protein goes through Cnx/Crt cycle for another round GII removes glucose to try again and pass QC of UGT1 BiP = hsc70 chaperone that recognizes exposed hydrophobic sequences on misfolded proteins

UDP-glucose glycoprotein glucosyltransferase (UGT1 a. k. a UDP-glucose glycoprotein glucosyltransferase (UGT1 a.k.a. UGGT or GT) is an ER folding sensor In vitro UGT1 reaction using RNAse as glycoprotein substrate Measure incorporation of [14C] glucose into the oligosaccharide attached to RNAse, compare native vs. denatured RNAse Result: Only denatured RNAse is a substrate. Best substrates in vitro are “nearly folded glycoprotein intermediates” not the native, compact structure or a terminally misfolded protein

Fate of newly synthesized glycoproteins in the ER III Folding-defective proteins need to be degraded - transported out of the ER for degradation How do proteins avoid futile cycles? UGT1 does not recognize fatally misfolded proteins and won’t reglucosylate them for binding to Cnx/Crt Resident mannosidases will trim mannose residues - protein can no longer be glucosylated and bind to Cnx/Crt BiP binds hydrophobic regions Mannosidase trimmed glycans recognized by OS9 associated with ubiquitination machinery Leads to kinetic competition between folding and degradation of newly synthesized glycoproteins Slow

Protein Processing and Quality Control in the Endoplasmic Reticulum Posttranslational modifications Protein folding Unfolded Native Unfolded protein response Exit from the ER ERAD: ER-associated degradation

ERAD: ER-associated degradation

ERAD mechanism based on complete reconstitution substrate Stein et al. Cell (2014) 158:1375-138 Baldridge and Rapoport Cell (2016) 166:394-407

What happens when ERAD isn’t enough and misfolded proteins accumulate?

Protein Processing and Quality Control in the Endoplasmic Reticulum Posttranslational modifications Protein folding Unfolded Native Unfolded protein response Exit from the ER ERAD: ER-associated degradation

Unfolded Protein Response (UPR) Intracellular signal transduction pathways that mediate communication between ER and nucleus Activated by accumulation of unfolded proteins in the lumen of the ER First characterized in yeast Conserved and more complex in animals, with at least three pathways

The UPR in yeast Ire1=inositol-requiring protein-1, ER-localized transmembrane kinase and site specific endoribonuclease Ire1 is maintained in inactive state by binding to BiP. Removal of BiP (by binding to misfolded proteins) leads to Ire1 activation Ire1 activation triggers splicing of intron in mRNA encoding Hac1, a dedicated UPR transcriptional activator Hac1 then binds to UPRE elements to selectively upregulate gene expression of targets that will help alleviate the overload of misfolded proteins

Microarray analysis identified mRNAs for proteins up-regulated by the UPR UPR induced in yeast by treatment with DTT or tunicamycin (Why??) Travers et al. Cell (2000) 150:77-88

Unfolded Protein Response in Metazoans Three branches Cells respond to ER stress by: Reducing the protein load that enters the ER Transient Decreased protein synthesis and translocation Increase ER capacity to handle unfolded proteins Longer term adaptation Transcriptional activation of UPR target genes Cell death Induced if the first two mechanisms fail to restore homeostasis

UPR also has physiological roles Rutkowski and Hegde, 2010

Misfolded proteins, ER stress, and disease Cystic fibrosis transmembrane conductance regulator DF508 mutation is well studied example (among 100s known) Protein could be functional as chloride channel at PM, but does not pass ER QC Ameliorative strategies include use of chemical chaperones, efforts to modulate specific folding factors, and efforts to adjust overall “proteostasis”

UPR as Achilles heel in Multiple Myeloma? UPR constitutively activated in setting of uncontrolled immunoglobulin secretion May make cells particularly vulnerable to drugs that interfere with ER stress response, thereby increasing apoptosis Proteasome inhibitors now in use, p97 inhibitors on the way Others?

Protein Processing and Quality Control in the Endoplasmic Reticulum Posttranslational modifications Protein folding Unfolded Native Unfolded protein response Exit from the ER ERAD: ER-associated degradation

ER exit sites defined as sites of COPII vesicle formation

Overview of COPII vesicle biogenesis

Minimal COPII machinery Five proteins added to liposomes or in vitro reactions form vesicles: Sar1p, Sec23p, Sec24p, Sec13p, Sec31p

How is cargo packaged into vesicles leaving the ER?

Live cell imaging of VSV-G transport VSV-G ts045 mutant tagged with GFP At 40°C, ts045 VSV-G is retained in the ER due to misfolding Shift to 32°C - traffics to the plasma membrane

Specific amino acid signals mediate selective transport Requirement of two acidic residues in the cytoplasmic tail of VSV-G for efficient export from the ER. Nishimura & Balch, Science 1997

Diacidic motifs are common theme in efficiently secreted proteins VSV-G TM-18aa -YTDIEMNRLGK CFTR TM-212aa-YKDADLYLLD-287aaTM GLUT4 TM-36aa -YLGPDEND LDLR TM-17aa -YQKTTEDEVHICH-20aa CI-M6PR TM-26aa -YSKVSKEEETDENE-127aa E-cadherin TM-95aa -YDSLLVFDYEGSGS-42aa EGFR TM-58aa -YKGLWIPEGEKVKIP-467aa ASGPR H1 MTKEYQDLQHLDNEES-24aaTM NGFR TM-65aa -YSSLPPAKREEVEKLLNG-74aa TfR -19aa -YTRFSLARQVDGDNSHV-26aaTM

COPII cargo binding site(s) (GAP) Cargo binding sites recognize ER export signals in cytoplasmic domains of cargo Best studied are the diacidic motifs in exiting membrane proteins, but there are others that bind to alternate sites in Sec24 (Cargo binding)

What about lumenal cargo? Two possibilities: -bulk flow, with specific retention of ER resident proteins -receptor mediated exit via binding to secreted TM protein

-Measure secretion of soluble model protein derived from Semliki Forest Virus capsid protein -Protein folds rapidly, no need for chaperones -Use pulse-chase analysis to follow newly synthesized protein -First molecule secreted 15 min after synthesis -Rate constant of secretion is 1.2% per minute, corresponding to bulk flow rate of 155 COPII vesicles per second Soluble proteins are efficiently secreted by bulk flow

And what about large cargo? Malhotra and Erlmann EMBO J 2011 30: 3475

How is ER volume and content maintained?

Retrograde traffic from Golgi to ER Includes receptor-mediated mechanism for retrieving ER resident proteins HDEL receptor identified in yeast - ERD2; multispanning transmembrane protein KDEL receptor in higher euks. Dilysine motif in C-terminal tail of receptor binds to COPI coat, lumenal domain binds HDEL/KDEL motif in pH dependent manner http://www.ergito.com/lookup.jsp?expt=pelham

Next lectures: Tuesday: Mechanism of membrane fusion Secretory pathway organelles and trafficking Thursday: Endocytic pathways and organelles